Incidental Mutation 'PIT4260001:Hacd4'
ID554490
Institutional Source Beutler Lab
Gene Symbol Hacd4
Ensembl Gene ENSMUSG00000028497
Gene Name3-hydroxyacyl-CoA dehydratase 4
Synonyms4933428I03Rik, Ptplad2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #PIT4260001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88396144-88438928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 88398105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 259 (R259T)
Ref Sequence ENSEMBL: ENSMUSP00000119411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000107147] [ENSMUST00000132493] [ENSMUST00000159342]
Predicted Effect probably benign
Transcript: ENSMUST00000097992
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107147
SMART Domains Protein: ENSMUSP00000102765
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
Pfam:DUF3028 1 204 8.6e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132493
AA Change: R259T
SMART Domains Protein: ENSMUSP00000119411
Gene: ENSMUSG00000028497
AA Change: R259T

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 80 234 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159342
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
Atp10a A T 7: 58,791,118 K504* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Myl6b T A 10: 128,496,306 Q97L possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pcdh1 A G 18: 38,203,366 V72A probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 Q281K possibly damaging Het
Prl7a2 A T 13: 27,659,276 Y181* probably null Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Hacd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Hacd4 APN 4 88423048 missense probably damaging 0.98
PIT4260001:Hacd4 UTSW 4 88398106 nonsense probably null
R0597:Hacd4 UTSW 4 88437520 missense probably damaging 1.00
R0625:Hacd4 UTSW 4 88435010 missense probably benign 0.04
R1054:Hacd4 UTSW 4 88423027 missense probably damaging 0.96
R1069:Hacd4 UTSW 4 88437502 missense probably damaging 0.99
R1478:Hacd4 UTSW 4 88423023 missense probably damaging 1.00
R1944:Hacd4 UTSW 4 88423066 missense possibly damaging 0.73
R2339:Hacd4 UTSW 4 88423099 critical splice acceptor site probably null
R3177:Hacd4 UTSW 4 88437510 missense probably damaging 1.00
R3277:Hacd4 UTSW 4 88437510 missense probably damaging 1.00
R3902:Hacd4 UTSW 4 88437501 missense probably damaging 1.00
R4429:Hacd4 UTSW 4 88434947 missense possibly damaging 0.50
R5834:Hacd4 UTSW 4 88398152 missense probably benign 0.00
R6242:Hacd4 UTSW 4 88414287 missense probably benign
R7252:Hacd4 UTSW 4 88426763 missense possibly damaging 0.73
R7508:Hacd4 UTSW 4 88437478 missense probably benign 0.06
R7857:Hacd4 UTSW 4 88437465 missense probably damaging 1.00
R8523:Hacd4 UTSW 4 88435049 missense probably damaging 1.00
X0004:Hacd4 UTSW 4 88423008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCAATCAGGTTTCCCAG -3'
(R):5'- CACCAGCAAGTTCTTTGTCAG -3'

Sequencing Primer
(F):5'- GGTGTCAATCAGGTTTCCCAGATTAC -3'
(R):5'- CCAGCAAGTTCTTTGTCAGGATATTC -3'
Posted On2019-06-07