Incidental Mutation 'PIT4260001:Prl7a2'
ID554514
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #PIT4260001 (G1)
Quality Score196.009
Status Not validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27659276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 181 (Y181*)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably null
Transcript: ENSMUST00000006660
AA Change: Y181*
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: Y181*

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
Atp10a A T 7: 58,791,118 K504* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hacd4 C G 4: 88,398,105 R259T unknown Het
Hacd4 T A 4: 88,398,106 R259* probably null Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Myl6b T A 10: 128,496,306 Q97L possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pcdh1 A G 18: 38,203,366 V72A probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 Q281K possibly damaging Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8298:Prl7a2 UTSW 13 27661011 missense probably benign 0.00
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GATTCAGCATCATGAAGCATCTC -3'
(R):5'- ATCACTGAATCCGTATAACTTGCAGG -3'

Sequencing Primer
(F):5'- TCACTACTAACATATACCACACACTC -3'
(R):5'- ATCCGTATAACTTGCAGGCAGGTATG -3'
Posted On2019-06-07