Incidental Mutation 'PIT4305001:Dstyk'
ID554528
Institutional Source Beutler Lab
Gene Symbol Dstyk
Ensembl Gene ENSMUSG00000042046
Gene Namedual serine/threonine and tyrosine protein kinase
SynonymsC430014H23Rik, A930019K20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #PIT4305001 (G1)
Quality Score197.009
Status Not validated
Chromosome1
Chromosomal Location132417555-132466958 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 132455896 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 617 (E617*)
Ref Sequence ENSEMBL: ENSMUSP00000035358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389]
Predicted Effect probably null
Transcript: ENSMUST00000045110
AA Change: E617*
SMART Domains Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046
AA Change: E617*

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Pfam:Pkinase_Tyr 651 904 6.9e-37 PFAM
Pfam:Pkinase 651 905 5.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187092
Predicted Effect probably null
Transcript: ENSMUST00000188389
AA Change: E617*
SMART Domains Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046
AA Change: E617*

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
S_TKc 650 859 2e-13 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Dstyk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dstyk APN 1 132459988 missense probably damaging 1.00
IGL01753:Dstyk APN 1 132462939 missense probably damaging 1.00
IGL02156:Dstyk APN 1 132449926 missense probably benign 0.27
IGL02175:Dstyk APN 1 132449391 nonsense probably null
IGL02721:Dstyk APN 1 132449316 missense probably benign 0.03
IGL03194:Dstyk APN 1 132456316 splice site probably benign
PIT4791001:Dstyk UTSW 1 132449927 missense probably benign 0.00
R0135:Dstyk UTSW 1 132462934 missense probably damaging 1.00
R0309:Dstyk UTSW 1 132456864 splice site probably benign
R0399:Dstyk UTSW 1 132453080 splice site probably benign
R0781:Dstyk UTSW 1 132453325 splice site probably benign
R1110:Dstyk UTSW 1 132453325 splice site probably benign
R1138:Dstyk UTSW 1 132463486 missense probably benign 0.00
R1300:Dstyk UTSW 1 132449913 missense probably benign 0.02
R1330:Dstyk UTSW 1 132449880 missense probably benign 0.25
R1509:Dstyk UTSW 1 132456346 missense probably damaging 1.00
R1667:Dstyk UTSW 1 132456919 missense probably damaging 1.00
R1728:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1729:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1730:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1739:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1757:Dstyk UTSW 1 132434094 splice site probably benign
R1762:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1783:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1784:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1785:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1829:Dstyk UTSW 1 132449595 missense probably benign 0.06
R2031:Dstyk UTSW 1 132453191 missense probably damaging 0.99
R2124:Dstyk UTSW 1 132453119 missense possibly damaging 0.64
R2132:Dstyk UTSW 1 132449484 missense probably null
R2143:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2144:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2145:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R3804:Dstyk UTSW 1 132449726 missense probably damaging 1.00
R4277:Dstyk UTSW 1 132455413 splice site probably null
R4504:Dstyk UTSW 1 132434389 missense possibly damaging 0.81
R4674:Dstyk UTSW 1 132463390 missense probably benign 0.42
R4697:Dstyk UTSW 1 132449487 missense probably damaging 0.98
R4828:Dstyk UTSW 1 132434137 missense probably benign
R4940:Dstyk UTSW 1 132453106 missense probably damaging 0.96
R5029:Dstyk UTSW 1 132449324 missense probably benign 0.01
R5678:Dstyk UTSW 1 132453291 missense probably benign
R5900:Dstyk UTSW 1 132456979 missense probably damaging 1.00
R5935:Dstyk UTSW 1 132454137 missense probably damaging 0.99
R5973:Dstyk UTSW 1 132434411 missense probably damaging 0.99
R6217:Dstyk UTSW 1 132459939 missense probably damaging 1.00
R6381:Dstyk UTSW 1 132456765 splice site probably null
R6429:Dstyk UTSW 1 132449804 nonsense probably null
R7038:Dstyk UTSW 1 132454109 missense probably benign 0.32
R7240:Dstyk UTSW 1 132454123 missense probably benign 0.02
R7411:Dstyk UTSW 1 132417666 missense probably benign 0.01
R7714:Dstyk UTSW 1 132456876 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGCATGACTGTTGACATCTC -3'
(R):5'- TGAGGCAGCTTTGCAAGGAG -3'

Sequencing Primer
(F):5'- GCATGACTGTTGACATCTCACTGC -3'
(R):5'- TTTGCAAGGAGGCCGGAGTC -3'
Posted On2019-06-07