Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Sardh'

554533

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

PIT4305001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27228314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 468 (N468S)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

probably damaging
Transcript: ENSMUST00000102886
AA Change: N468S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: N468S

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386	V104A	possibly damaging	Het
Celsr1	T	A	15: 85,900,937	E3032V	possibly damaging	Het
Cts7	A	G	13: 61,356,572	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671	T161A		Het
Hspg2	T	C	4: 137,550,373	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852	I129N	probably damaging	Het
Kif1b	T	C	4: 149,220,792		probably null	Het
Klrd1	A	G	6: 129,596,707	T120A	unknown	Het
Lfng	A	G	5: 140,612,528	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067	E757G	probably damaging	Het
Ltn1	G	A	16: 87,420,323	P342L	probably damaging	Het
Lum	A	C	10: 97,568,876	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829	Q420R		Het
Prl7d1	A	T	13: 27,714,337	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958	V166A		Het
Robo4	T	C	9: 37,411,391	Y847H	probably damaging	Het
Sema5a	A	G	15: 32,628,199	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227	G2305R	possibly damaging	Het
Ticrr	A	G	7: 79,679,023	T637A	possibly damaging	Het
Tnn	A	T	1: 160,086,077	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663	I6K	probably benign	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCCTGTGGAAACTAGTC -3'
(R):5'- GTGACTGAGTAAAGAGGCTAACCC -3'

Sequencing Primer
(F):5'- GTGGAAACTAGTCTCTTCCACC -3'
(R):5'- TAACCCTGGCCCAGATTTGGTG -3'

Posted On

2019-06-07