Incidental Mutation 'PIT4305001:Olfr1231'
ID554535
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #PIT4305001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89303383 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 70 (I70V)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect probably benign
Transcript: ENSMUST00000099786
AA Change: I70V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I70V

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
AA Change: I70V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0974:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4208:Olfr1231 UTSW 2 89302926 missense probably damaging 1.00
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4693:Olfr1231 UTSW 2 89303277 missense probably benign 0.07
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R6894:Olfr1231 UTSW 2 89303493 missense probably damaging 1.00
R8019:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTTTGCATATGGCCACGTAG -3'
(R):5'- GGGAAGGCTTTATATCCTGAATGG -3'

Sequencing Primer
(F):5'- CGTAGCGGTCATAGGCCATAAC -3'
(R):5'- ACAGTCCTCCCAGTAATGTGACTG -3'
Posted On2019-06-07