Incidental Mutation 'PIT4305001:Syt6'
ID 554538
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # PIT4305001 (G1)
Quality Score 85.0076
Status Not validated
Chromosome 3
Chromosomal Location 103575231-103645569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103575453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 26 (R26W)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
AlphaFold Q9R0N8
Predicted Effect possibly damaging
Transcript: ENSMUST00000090697
AA Change: R26W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: R26W

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117221
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118117
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121834
AA Change: R26W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: R26W

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132325
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849
AA Change: R26W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136049
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849
AA Change: R26W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151985
AA Change: R26W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000183637
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
R8768:Syt6 UTSW 3 103585534 missense probably benign
R8867:Syt6 UTSW 3 103627055 missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103625625 missense probably benign 0.06
R9068:Syt6 UTSW 3 103587509 nonsense probably null
R9098:Syt6 UTSW 3 103585579 missense probably damaging 0.96
R9361:Syt6 UTSW 3 103575363 unclassified probably benign
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGCATGATGTGGGACAG -3'
(R):5'- TCCGAGCTAGACTTCTGAGG -3'

Sequencing Primer
(F):5'- AGGCAAGTCCCTGAGTGTG -3'
(R):5'- CCGAGCTAGACTTCTGAGGTTCTG -3'
Posted On 2019-06-07