Incidental Mutation 'PIT4305001:Rap1gds1'
ID 554539
Institutional Source Beutler Lab
Gene Symbol Rap1gds1
Ensembl Gene ENSMUSG00000028149
Gene Name RAP1, GTP-GDP dissociation stimulator 1
Synonyms GDS1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138925902-139075201 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 138956300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 398 (M398I)
Ref Sequence ENSEMBL: ENSMUSP00000096173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029796] [ENSMUST00000098574] [ENSMUST00000196106] [ENSMUST00000196280] [ENSMUST00000200396]
AlphaFold E9Q912
Predicted Effect possibly damaging
Transcript: ENSMUST00000029796
AA Change: M349I

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029796
Gene: ENSMUSG00000028149
AA Change: M349I

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 119 162 7.98e-4 SMART
ARM 297 341 2.4e-7 SMART
ARM 342 382 6.3e1 SMART
ARM 430 470 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098574
AA Change: M398I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096173
Gene: ENSMUSG00000028149
AA Change: M398I

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 479 519 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196106
Predicted Effect probably benign
Transcript: ENSMUST00000196280
AA Change: M398I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143181
Gene: ENSMUSG00000028149
AA Change: M398I

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 478 518 6.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200396
AA Change: M349I

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143517
Gene: ENSMUSG00000028149
AA Change: M349I

DomainStartEndE-ValueType
ARM 77 118 6.7e-9 SMART
ARM 119 162 3.9e-6 SMART
ARM 297 341 1.2e-9 SMART
ARM 342 382 3.1e-1 SMART
ARM 430 470 3.1e-5 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Rap1gds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rap1gds1 APN 3 138983827 missense possibly damaging 0.95
IGL01314:Rap1gds1 APN 3 139050561 missense probably damaging 1.00
IGL01450:Rap1gds1 APN 3 138965920 missense probably damaging 1.00
IGL02033:Rap1gds1 APN 3 138955471 splice site probably benign
IGL02658:Rap1gds1 APN 3 138957479 missense probably damaging 1.00
IGL02745:Rap1gds1 APN 3 138956241 missense probably damaging 1.00
IGL02880:Rap1gds1 APN 3 138945756 missense probably benign 0.16
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0585:Rap1gds1 UTSW 3 139021872 missense probably benign 0.16
R1573:Rap1gds1 UTSW 3 138965863 splice site probably null
R1793:Rap1gds1 UTSW 3 139050553 missense possibly damaging 0.94
R1960:Rap1gds1 UTSW 3 139050556 missense probably null 0.28
R2432:Rap1gds1 UTSW 3 138956250 missense probably damaging 0.99
R2697:Rap1gds1 UTSW 3 138983721 critical splice donor site probably null
R3792:Rap1gds1 UTSW 3 138965960 missense probably damaging 1.00
R4031:Rap1gds1 UTSW 3 139050592 splice site probably benign
R4194:Rap1gds1 UTSW 3 138959090 missense probably damaging 1.00
R4530:Rap1gds1 UTSW 3 138957425 missense probably damaging 1.00
R4696:Rap1gds1 UTSW 3 138927614 missense probably damaging 1.00
R4909:Rap1gds1 UTSW 3 138983748 missense possibly damaging 0.77
R5000:Rap1gds1 UTSW 3 138956250 missense probably damaging 1.00
R5046:Rap1gds1 UTSW 3 138955420 nonsense probably null
R5152:Rap1gds1 UTSW 3 138956201 missense probably damaging 1.00
R5163:Rap1gds1 UTSW 3 138959056 missense probably damaging 0.99
R5309:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5312:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5782:Rap1gds1 UTSW 3 138959079 missense possibly damaging 0.65
R5825:Rap1gds1 UTSW 3 138955375 missense possibly damaging 0.93
R6547:Rap1gds1 UTSW 3 138955338 missense probably damaging 1.00
R7227:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7228:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7574:Rap1gds1 UTSW 3 138956215 nonsense probably null
R7711:Rap1gds1 UTSW 3 138959113 missense probably benign 0.08
R8035:Rap1gds1 UTSW 3 139015550 missense probably damaging 1.00
R8432:Rap1gds1 UTSW 3 138941787 missense probably damaging 0.99
R8736:Rap1gds1 UTSW 3 138941751 missense probably benign 0.00
R8768:Rap1gds1 UTSW 3 138941760 missense probably benign 0.00
R8901:Rap1gds1 UTSW 3 138957544 missense probably damaging 1.00
R9008:Rap1gds1 UTSW 3 138955416 missense probably benign 0.05
R9526:Rap1gds1 UTSW 3 139050556 missense probably benign 0.00
RF053:Rap1gds1 UTSW 3 138941657 frame shift probably null
Z1177:Rap1gds1 UTSW 3 139050539 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGTGTCTGAGCGATCAG -3'
(R):5'- GTCTGCTGTGTTCCAGTAAACAG -3'

Sequencing Primer
(F):5'- GTGTCTGAGCGATCAGTAACAAATC -3'
(R):5'- GAAACAGGTTATCCCAGGTTAGTCTC -3'
Posted On 2019-06-07