Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Kif1b'

554543

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4305001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 149220792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000056754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

probably null
Transcript: ENSMUST00000055647

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000060537

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386	V104A	possibly damaging	Het
Celsr1	T	A	15: 85,900,937	E3032V	possibly damaging	Het
Cts7	A	G	13: 61,356,572	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671	T161A		Het
Hspg2	T	C	4: 137,550,373	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852	I129N	probably damaging	Het
Klrd1	A	G	6: 129,596,707	T120A	unknown	Het
Lfng	A	G	5: 140,612,528	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067	E757G	probably damaging	Het
Ltn1	G	A	16: 87,420,323	P342L	probably damaging	Het
Lum	A	C	10: 97,568,876	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829	Q420R		Het
Prl7d1	A	T	13: 27,714,337	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958	V166A		Het
Robo4	T	C	9: 37,411,391	Y847H	probably damaging	Het
Sardh	T	C	2: 27,228,314	N468S	probably damaging	Het
Sema5a	A	G	15: 32,628,199	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227	G2305R	possibly damaging	Het
Ticrr	A	G	7: 79,679,023	T637A	possibly damaging	Het
Tnn	A	T	1: 160,086,077	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663	I6K	probably benign	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0360:Kif1b	UTSW	4	149262729	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2124:Kif1b	UTSW	4	149222296	missense	probably benign	0.08
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6137:Kif1b	UTSW	4	149238426	missense	possibly damaging	0.47
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6463:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7065:Kif1b	UTSW	4	149202525	missense	possibly damaging	0.46
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
R9450:Kif1b	UTSW	4	149238010	missense	probably benign	0.01
R9478:Kif1b	UTSW	4	149261159	critical splice donor site	probably null
R9571:Kif1b	UTSW	4	149220641	missense	probably damaging	1.00
R9644:Kif1b	UTSW	4	149291379	missense	probably damaging	1.00
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CGGTCGTAAAATGGGTCATGC -3'
(R):5'- GTAGATCTCTTCAGCCTGCC -3'

Sequencing Primer
(F):5'- GGTCATGCCCATCACTGAAGAG -3'
(R):5'- CCCGATCCCTTTGCCTGAAC -3'

Posted On

2019-06-07