Incidental Mutation 'PIT4305001:Gsap'
ID 554545
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Name gamma-secretase activating protein
Synonyms A530088I07Rik, Pion
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # PIT4305001 (G1)
Quality Score 152.008
Status Not validated
Chromosome 5
Chromosomal Location 21186255-21315132 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21186409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000043679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]
AlphaFold Q3TCV3
Predicted Effect probably damaging
Transcript: ENSMUST00000036031
AA Change: L16P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: L16P

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195969
AA Change: L16P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000198014
AA Change: L16P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000198071
AA Change: L16P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000198937
AA Change: L16P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: L16P

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 splice site probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5031:Gsap UTSW 5 21242826 missense possibly damaging 0.57
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5469:Gsap UTSW 5 21290544 missense possibly damaging 0.92
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R5650:Gsap UTSW 5 21251053 missense probably damaging 0.99
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7234:Gsap UTSW 5 21186435 missense probably benign
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
R8047:Gsap UTSW 5 21257868 critical splice acceptor site probably null
R8062:Gsap UTSW 5 21194463 missense probably damaging 1.00
R8126:Gsap UTSW 5 21270012 missense probably benign 0.04
R8219:Gsap UTSW 5 21251115 missense probably benign 0.00
R8355:Gsap UTSW 5 21251019 nonsense probably null
R8472:Gsap UTSW 5 21222434 nonsense probably null
R8715:Gsap UTSW 5 21226247 missense possibly damaging 0.84
R8745:Gsap UTSW 5 21269951 missense probably benign 0.05
R8798:Gsap UTSW 5 21271250 critical splice donor site probably null
R9080:Gsap UTSW 5 21194412 missense possibly damaging 0.52
R9120:Gsap UTSW 5 21253436 missense probably damaging 1.00
R9178:Gsap UTSW 5 21217473 missense probably damaging 0.98
R9209:Gsap UTSW 5 21228066 missense probably benign 0.10
R9404:Gsap UTSW 5 21269921 missense probably damaging 1.00
Z1177:Gsap UTSW 5 21251032 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGACTAAAGAAAACCTGCC -3'
(R):5'- CACTCATTGCACAGGCTTG -3'

Sequencing Primer
(F):5'- TCCAGTCTGGAAGCTGCTG -3'
(R):5'- CTATGGGACTTCGGGTGA -3'
Posted On 2019-06-07