Incidental Mutation 'PIT4305001:Drd5'
ID 554547
Institutional Source Beutler Lab
Gene Symbol Drd5
Ensembl Gene ENSMUSG00000039358
Gene Name dopamine receptor D5
Synonyms D5R, Gpcr1, Drd1b, Drd-5, DRD1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 38319367-38322518 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38320584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 307 (F307L)
Ref Sequence ENSEMBL: ENSMUSP00000039691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041646]
AlphaFold Q8BLD9
Predicted Effect probably damaging
Transcript: ENSMUST00000041646
AA Change: F307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: F307L

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 47 177 5.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 49 179 1e-7 PFAM
Pfam:7tm_1 55 354 1.5e-74 PFAM
Pfam:7TM_GPCR_Srsx 210 368 2.4e-6 PFAM
low complexity region 419 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Drd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Drd5 APN 5 38319781 missense probably benign 0.25
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0571:Drd5 UTSW 5 38319927 missense probably damaging 1.00
R1507:Drd5 UTSW 5 38320722 missense probably damaging 1.00
R1663:Drd5 UTSW 5 38320855 missense probably benign 0.02
R1777:Drd5 UTSW 5 38320161 missense probably damaging 1.00
R1932:Drd5 UTSW 5 38319976 missense probably benign 0.14
R1986:Drd5 UTSW 5 38320113 missense probably damaging 0.99
R2047:Drd5 UTSW 5 38320336 missense probably damaging 1.00
R3875:Drd5 UTSW 5 38319814 missense possibly damaging 0.84
R5033:Drd5 UTSW 5 38320201 missense probably damaging 1.00
R5201:Drd5 UTSW 5 38320023 missense probably damaging 0.96
R5255:Drd5 UTSW 5 38319967 missense probably damaging 1.00
R5393:Drd5 UTSW 5 38320905 missense probably benign
R5639:Drd5 UTSW 5 38319835 missense possibly damaging 0.81
R7241:Drd5 UTSW 5 38320536 missense probably damaging 1.00
R7520:Drd5 UTSW 5 38320852 missense probably benign 0.00
R7739:Drd5 UTSW 5 38320078 missense probably damaging 1.00
R8300:Drd5 UTSW 5 38320329 missense probably damaging 0.99
R8746:Drd5 UTSW 5 38320090 missense probably benign 0.04
R8829:Drd5 UTSW 5 38319735 missense probably benign 0.08
R8832:Drd5 UTSW 5 38319735 missense probably benign 0.08
R8870:Drd5 UTSW 5 38320404 missense possibly damaging 0.76
R9600:Drd5 UTSW 5 38320831 missense possibly damaging 0.79
R9705:Drd5 UTSW 5 38320684 missense probably damaging 1.00
R9717:Drd5 UTSW 5 38320747 missense probably damaging 1.00
Z1177:Drd5 UTSW 5 38320386 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CGGTAGCCATCATGATAGTGAC -3'
(R):5'- AACACCTTCCGGAAGTCTGC -3'

Sequencing Primer
(F):5'- ATTGCACAGGTTCAGATCCG -3'
(R):5'- CCTTCCGGAAGTCTGCATTAAAGG -3'
Posted On 2019-06-07