Incidental Mutation 'PIT4305001:Lfng'
ID 554548
Institutional Source Beutler Lab
Gene Symbol Lfng
Ensembl Gene ENSMUSG00000029570
Gene Name LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms lunatic fringe
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 140607320-140615545 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140612528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 202 (N202D)
Ref Sequence ENSEMBL: ENSMUSP00000031555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031555]
AlphaFold O09010
Predicted Effect probably damaging
Transcript: ENSMUST00000031555
AA Change: N202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031555
Gene: ENSMUSG00000029570
AA Change: N202D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 37 60 N/A INTRINSIC
Pfam:Fringe 107 357 9.6e-124 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a short tail and abnormal rib, somite, and lung development. Mice homozygous mice exhibit reduced female fertility, abnormal hair cells, and abnormal axial skeleton morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Lfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Lfng APN 5 140612535 missense probably damaging 1.00
zigzag UTSW 5 140612535 missense probably damaging 1.00
R2070:Lfng UTSW 5 140612595 missense possibly damaging 0.63
R2848:Lfng UTSW 5 140611867 missense probably damaging 1.00
R2849:Lfng UTSW 5 140611867 missense probably damaging 1.00
R4689:Lfng UTSW 5 140614439 missense probably damaging 0.99
R4936:Lfng UTSW 5 140612395 splice site probably null
R5516:Lfng UTSW 5 140613263 missense probably damaging 1.00
R5560:Lfng UTSW 5 140614267 missense possibly damaging 0.89
R6334:Lfng UTSW 5 140612767 missense possibly damaging 0.86
R6380:Lfng UTSW 5 140614396 splice site probably null
R6627:Lfng UTSW 5 140607768 missense probably damaging 1.00
R7832:Lfng UTSW 5 140612833 missense probably benign 0.07
R7853:Lfng UTSW 5 140607629 missense probably benign 0.01
R8367:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8368:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8384:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8385:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8407:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8435:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8494:Lfng UTSW 5 140613226 missense probably damaging 1.00
R8896:Lfng UTSW 5 140613223 missense probably benign 0.15
R9803:Lfng UTSW 5 140607773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTGGAGTATGACCGATTC -3'
(R):5'- ACAGGTCTCTGGGTGAAGTG -3'

Sequencing Primer
(F):5'- ACCGATTCATTGAGTCTGGGAAG -3'
(R):5'- TTGCAAAGGTGGCTCAGC -3'
Posted On 2019-06-07