Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Ticrr'

554557

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

PIT4305001 (G1)

Quality Score

175.009

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79679023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 637 (T637A)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: T637A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: T637A

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206017

Predicted Effect

probably damaging
Transcript: ENSMUST00000206591
AA Change: T637A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206622
AA Change: T637A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386	V104A	possibly damaging	Het
Celsr1	T	A	15: 85,900,937	E3032V	possibly damaging	Het
Cts7	A	G	13: 61,356,572	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671	T161A		Het
Hspg2	T	C	4: 137,550,373	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852	I129N	probably damaging	Het
Kif1b	T	C	4: 149,220,792		probably null	Het
Klrd1	A	G	6: 129,596,707	T120A	unknown	Het
Lfng	A	G	5: 140,612,528	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067	E757G	probably damaging	Het
Ltn1	G	A	16: 87,420,323	P342L	probably damaging	Het
Lum	A	C	10: 97,568,876	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829	Q420R		Het
Prl7d1	A	T	13: 27,714,337	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958	V166A		Het
Robo4	T	C	9: 37,411,391	Y847H	probably damaging	Het
Sardh	T	C	2: 27,228,314	N468S	probably damaging	Het
Sema5a	A	G	15: 32,628,199	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227	G2305R	possibly damaging	Het
Tnn	A	T	1: 160,086,077	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663	I6K	probably benign	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GGCACTGTGGAACATTTCAC -3'
(R):5'- GGATGTGCACTAAACCCACC -3'

Sequencing Primer
(F):5'- ACTGTGGAACATTTCACGTCATC -3'
(R):5'- CCATCAAACACTACATTTATGGCAG -3'

Posted On

2019-06-07