Incidental Mutation 'PIT4305001:Robo4'
ID 554562
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Name roundabout guidance receptor 4
Synonyms Magic roundabout, 1200012D01Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 37313198-37325319 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37322687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 847 (Y847H)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
AlphaFold Q8C310
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102895
AA Change: Y840H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: Y840H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115046
AA Change: Y899H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: Y899H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: Y736H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect probably damaging
Transcript: ENSMUST00000214185
AA Change: Y847H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,086,610 (GRCm39) N801D probably benign Het
Adcy2 T C 13: 68,826,721 (GRCm39) K661R probably benign Het
Akap1 A T 11: 88,735,204 (GRCm39) M486K probably benign Het
Arhgap40 T A 2: 158,373,825 (GRCm39) I202N probably benign Het
C1qtnf2 T A 11: 43,382,022 (GRCm39) L248Q probably damaging Het
Casp1 A T 9: 5,306,135 (GRCm39) H340L probably benign Het
Cd5 A G 19: 10,703,750 (GRCm39) V104A possibly damaging Het
Celsr1 T A 15: 85,785,138 (GRCm39) E3032V possibly damaging Het
Cts7 A G 13: 61,504,386 (GRCm39) I59T probably damaging Het
Cutc G T 19: 43,756,708 (GRCm39) A267S probably damaging Het
Dmwd A G 7: 18,814,643 (GRCm39) Q431R probably damaging Het
Dnah6 T C 6: 73,042,738 (GRCm39) N3280S probably benign Het
Dnah7b A T 1: 46,412,508 (GRCm39) N4039I probably damaging Het
Dnaja4 T C 9: 54,617,918 (GRCm39) I260T probably benign Het
Drd5 T C 5: 38,477,927 (GRCm39) F307L probably damaging Het
Dsc2 C T 18: 20,179,300 (GRCm39) S256N probably damaging Het
Dstyk G T 1: 132,383,634 (GRCm39) E617* probably null Het
Dusp15 G A 2: 152,787,396 (GRCm39) H72Y probably benign Het
Dysf C T 6: 84,077,216 (GRCm39) R660* probably null Het
Fbxl13 T A 5: 21,727,146 (GRCm39) I584L probably benign Het
Gsap T C 5: 21,391,407 (GRCm39) L16P probably damaging Het
Hgsnat C T 8: 26,435,227 (GRCm39) A636T possibly damaging Het
Hivep1 A G 13: 42,335,147 (GRCm39) T161A Het
Hspg2 T C 4: 137,277,684 (GRCm39) S2928P possibly damaging Het
Ifi214 G A 1: 173,355,485 (GRCm39) P108S probably benign Het
Il17ra A T 6: 120,458,367 (GRCm39) Y506F probably damaging Het
Il9r T A 11: 32,144,734 (GRCm39) Q53L probably benign Het
Irf2bp2 C T 8: 127,319,398 (GRCm39) G260R probably damaging Het
Jdp2 T A 12: 85,685,626 (GRCm39) I129N probably damaging Het
Kif1b T C 4: 149,305,249 (GRCm39) probably null Het
Klrd1 A G 6: 129,573,670 (GRCm39) T120A unknown Het
Lfng A G 5: 140,598,283 (GRCm39) N202D probably damaging Het
Ltbp3 A G 19: 5,802,095 (GRCm39) E757G probably damaging Het
Ltn1 G A 16: 87,217,211 (GRCm39) P342L probably damaging Het
Lum A C 10: 97,404,738 (GRCm39) Y211S probably damaging Het
Ncapd2 G A 6: 125,160,990 (GRCm39) R292* probably null Het
Nlrc4 T C 17: 74,753,304 (GRCm39) T360A probably damaging Het
Or4c1 T C 2: 89,133,727 (GRCm39) I70V probably benign Het
Or7g32 T C 9: 19,389,357 (GRCm39) Y63C probably damaging Het
Pakap C A 4: 57,638,029 (GRCm39) T22K possibly damaging Het
Pde3a A G 6: 141,438,036 (GRCm39) D1035G probably benign Het
Phf20l1 A T 15: 66,484,901 (GRCm39) K322I possibly damaging Het
Pik3r3 A C 4: 116,149,323 (GRCm39) N349T probably benign Het
Poc1a A G 9: 106,227,028 (GRCm39) Q420R Het
Prl7d1 A T 13: 27,898,320 (GRCm39) M63K possibly damaging Het
Rap1gds1 C A 3: 138,662,061 (GRCm39) M398I probably benign Het
Rapgef6 T A 11: 54,570,203 (GRCm39) V1192D probably damaging Het
Rif1 T C 2: 52,001,970 (GRCm39) V166A Het
Sardh T C 2: 27,118,326 (GRCm39) N468S probably damaging Het
Sema5a A G 15: 32,628,345 (GRCm39) T553A probably benign Het
Serpina12 A G 12: 104,001,976 (GRCm39) Y247H probably damaging Het
Speer4e2 T C 5: 15,028,804 (GRCm39) D29G probably benign Het
Ston2 G T 12: 91,615,276 (GRCm39) D377E possibly damaging Het
Syne1 A G 10: 5,283,023 (GRCm39) S1557P probably damaging Het
Syt6 C T 3: 103,482,769 (GRCm39) R26W possibly damaging Het
Tep1 C T 14: 51,066,684 (GRCm39) G2305R possibly damaging Het
Ticrr A G 7: 79,328,771 (GRCm39) T637A possibly damaging Het
Tnn A T 1: 159,913,647 (GRCm39) F1546Y possibly damaging Het
Tpr A G 1: 150,315,888 (GRCm39) D2055G possibly damaging Het
Trim39 A G 17: 36,579,862 (GRCm39) V31A possibly damaging Het
Trpc7 G T 13: 57,035,321 (GRCm39) T204K probably benign Het
Urgcp T C 11: 5,667,996 (GRCm39) Y157C probably damaging Het
Vmn1r81 A T 7: 11,994,590 (GRCm39) I6K probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37,322,400 (GRCm39) missense probably damaging 1.00
IGL00392:Robo4 APN 9 37,319,525 (GRCm39) missense probably damaging 1.00
IGL00491:Robo4 APN 9 37,317,231 (GRCm39) missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37,319,507 (GRCm39) missense probably damaging 1.00
IGL01062:Robo4 APN 9 37,317,296 (GRCm39) missense probably benign 0.08
IGL01287:Robo4 APN 9 37,324,336 (GRCm39) missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37,319,496 (GRCm39) missense probably damaging 1.00
IGL02486:Robo4 APN 9 37,319,670 (GRCm39) missense probably damaging 1.00
IGL02851:Robo4 APN 9 37,324,678 (GRCm39) missense probably damaging 0.96
IGL02898:Robo4 APN 9 37,319,472 (GRCm39) missense probably damaging 0.99
IGL02965:Robo4 APN 9 37,321,765 (GRCm39) missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37,315,580 (GRCm39) splice site probably benign
IGL03102:Robo4 APN 9 37,315,481 (GRCm39) missense probably damaging 1.00
H8562:Robo4 UTSW 9 37,317,106 (GRCm39) intron probably benign
R0056:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0068:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0416:Robo4 UTSW 9 37,316,062 (GRCm39) splice site probably benign
R1005:Robo4 UTSW 9 37,319,547 (GRCm39) missense probably damaging 1.00
R1174:Robo4 UTSW 9 37,324,348 (GRCm39) missense probably damaging 1.00
R1183:Robo4 UTSW 9 37,319,348 (GRCm39) missense probably damaging 1.00
R1254:Robo4 UTSW 9 37,322,136 (GRCm39) critical splice donor site probably null
R1398:Robo4 UTSW 9 37,319,372 (GRCm39) critical splice donor site probably null
R1505:Robo4 UTSW 9 37,314,523 (GRCm39) missense probably damaging 0.98
R1701:Robo4 UTSW 9 37,314,739 (GRCm39) missense probably benign 0.44
R1834:Robo4 UTSW 9 37,324,355 (GRCm39) missense probably benign 0.09
R1899:Robo4 UTSW 9 37,315,366 (GRCm39) splice site probably benign
R2203:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2204:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2351:Robo4 UTSW 9 37,322,956 (GRCm39) missense probably benign 0.01
R2448:Robo4 UTSW 9 37,313,958 (GRCm39) missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37,315,772 (GRCm39) nonsense probably null
R2851:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2852:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2877:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3123:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3124:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3125:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3805:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3905:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R3938:Robo4 UTSW 9 37,313,313 (GRCm39) start gained probably benign
R4261:Robo4 UTSW 9 37,316,877 (GRCm39) missense probably benign 0.04
R4434:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4435:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4561:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4562:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4568:Robo4 UTSW 9 37,316,118 (GRCm39) missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37,314,495 (GRCm39) missense probably damaging 1.00
R4921:Robo4 UTSW 9 37,313,856 (GRCm39) missense probably benign
R5000:Robo4 UTSW 9 37,319,664 (GRCm39) missense probably benign 0.02
R5056:Robo4 UTSW 9 37,316,102 (GRCm39) missense probably benign 0.00
R5125:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5178:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5278:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5279:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5285:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5347:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5348:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5361:Robo4 UTSW 9 37,324,674 (GRCm39) missense probably benign 0.01
R5403:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5404:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5488:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5489:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5490:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5494:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5629:Robo4 UTSW 9 37,319,658 (GRCm39) missense probably damaging 1.00
R5736:Robo4 UTSW 9 37,316,093 (GRCm39) missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37,322,970 (GRCm39) missense probably benign 0.00
R5987:Robo4 UTSW 9 37,322,696 (GRCm39) missense probably damaging 1.00
R6178:Robo4 UTSW 9 37,316,926 (GRCm39) nonsense probably null
R6189:Robo4 UTSW 9 37,314,829 (GRCm39) missense probably benign 0.35
R6365:Robo4 UTSW 9 37,322,008 (GRCm39) missense probably benign 0.34
R6528:Robo4 UTSW 9 37,315,664 (GRCm39) missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37,313,363 (GRCm39) missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37,314,001 (GRCm39) missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37,322,277 (GRCm39) missense probably benign 0.09
R7419:Robo4 UTSW 9 37,314,105 (GRCm39) missense probably benign 0.18
R7486:Robo4 UTSW 9 37,316,870 (GRCm39) missense probably damaging 0.99
R7707:Robo4 UTSW 9 37,324,418 (GRCm39) missense probably damaging 1.00
R7839:Robo4 UTSW 9 37,322,055 (GRCm39) missense probably damaging 1.00
R8079:Robo4 UTSW 9 37,313,931 (GRCm39) missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37,316,936 (GRCm39) missense probably damaging 0.99
R8280:Robo4 UTSW 9 37,315,372 (GRCm39) missense probably benign 0.00
R8526:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R8547:Robo4 UTSW 9 37,315,674 (GRCm39) missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37,319,577 (GRCm39) missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37,317,130 (GRCm39) missense unknown
R8889:Robo4 UTSW 9 37,314,601 (GRCm39) missense probably benign 0.00
R9018:Robo4 UTSW 9 37,315,520 (GRCm39) missense probably benign 0.00
R9182:Robo4 UTSW 9 37,313,206 (GRCm39) start gained probably benign
R9375:Robo4 UTSW 9 37,316,158 (GRCm39) missense probably damaging 1.00
R9621:Robo4 UTSW 9 37,317,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGAGTACTCTGGGAGAG -3'
(R):5'- CTGAGGCCAAAGCTATCCACAG -3'

Sequencing Primer
(F):5'- TCTGGGAGAGCCGAAACACTAC -3'
(R):5'- AAGAGCTAACCAGGCTGGCC -3'
Posted On 2019-06-07