Incidental Mutation 'PIT4305001:Robo4'
ID554562
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #PIT4305001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37411391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 847 (Y847H)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102895
AA Change: Y840H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: Y840H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115046
AA Change: Y899H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: Y899H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: Y736H

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect probably damaging
Transcript: ENSMUST00000214185
AA Change: Y847H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37408281 missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37405834 missense unknown
R8889:Robo4 UTSW 9 37403305 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTGAGTACTCTGGGAGAG -3'
(R):5'- CTGAGGCCAAAGCTATCCACAG -3'

Sequencing Primer
(F):5'- TCTGGGAGAGCCGAAACACTAC -3'
(R):5'- AAGAGCTAACCAGGCTGGCC -3'
Posted On2019-06-07