Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Robo4'

554562

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.281) question?

Stock #

PIT4305001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37411391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 847 (Y847H)

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

probably benign
Transcript: ENSMUST00000034643

SMART Domains

Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
IGc2	54	128	9.7e-11	SMART
IGc2	156	221	1.44e-4	SMART
IGc2	248	311	1.89e-13	SMART
IGc2	337	409	9.84e-12	SMART
IGc2	441	506	2.09e-15	SMART
FN3	534	616	4.24e-14	SMART
FN3	648	731	3.06e0	SMART
FN3	747	832	1.97e-9	SMART
low complexity region	870	890	N/A	INTRINSIC
low complexity region	1055	1082	N/A	INTRINSIC
low complexity region	1131	1149	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC
low complexity region	1193	1206	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1336	1376	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102895
AA Change: Y840H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: Y840H

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115038

SMART Domains

Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
IGc2	76	150	9.7e-11	SMART
IGc2	178	243	1.44e-4	SMART
IGc2	270	333	1.89e-13	SMART
IGc2	359	431	9.84e-12	SMART
IGc2	463	528	2.09e-15	SMART
FN3	556	638	4.24e-14	SMART
FN3	670	753	3.06e0	SMART
FN3	769	854	1.97e-9	SMART
low complexity region	892	912	N/A	INTRINSIC
low complexity region	1077	1104	N/A	INTRINSIC
low complexity region	1153	1171	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
low complexity region	1215	1228	N/A	INTRINSIC
low complexity region	1267	1278	N/A	INTRINSIC
low complexity region	1290	1303	N/A	INTRINSIC
low complexity region	1358	1398	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115046
AA Change: Y899H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: Y899H

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: Y736H

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

probably benign
Transcript: ENSMUST00000170512

Predicted Effect

probably damaging
Transcript: ENSMUST00000214185
AA Change: Y847H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386	V104A	possibly damaging	Het
Celsr1	T	A	15: 85,900,937	E3032V	possibly damaging	Het
Cts7	A	G	13: 61,356,572	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671	T161A		Het
Hspg2	T	C	4: 137,550,373	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852	I129N	probably damaging	Het
Kif1b	T	C	4: 149,220,792		probably null	Het
Klrd1	A	G	6: 129,596,707	T120A	unknown	Het
Lfng	A	G	5: 140,612,528	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067	E757G	probably damaging	Het
Ltn1	G	A	16: 87,420,323	P342L	probably damaging	Het
Lum	A	C	10: 97,568,876	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829	Q420R		Het
Prl7d1	A	T	13: 27,714,337	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958	V166A		Het
Sardh	T	C	2: 27,228,314	N468S	probably damaging	Het
Sema5a	A	G	15: 32,628,199	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227	G2305R	possibly damaging	Het
Ticrr	A	G	7: 79,679,023	T637A	possibly damaging	Het
Tnn	A	T	1: 160,086,077	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663	I6K	probably benign	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37402635	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37405640	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37404076	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37403505	nonsense	probably null
R8547:Robo4	UTSW	9	37404378	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37408281	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37405834	missense	unknown
R8889:Robo4	UTSW	9	37403305	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37404224	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37401910	start gained	probably benign
R9375:Robo4	UTSW	9	37404862	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37406213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTGAGTACTCTGGGAGAG -3'
(R):5'- CTGAGGCCAAAGCTATCCACAG -3'

Sequencing Primer
(F):5'- TCTGGGAGAGCCGAAACACTAC -3'
(R):5'- AAGAGCTAACCAGGCTGGCC -3'

Posted On

2019-06-07