Incidental Mutation 'PIT4305001:Dnaja4'
ID554563
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene NameDnaJ heat shock protein family (Hsp40) member A4
Synonyms1110021L12Rik, Hsj4, Dj4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4305001 (G1)
Quality Score171.009
Status Not validated
Chromosome9
Chromosomal Location54698873-54716315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54710634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 260 (I260T)
Ref Sequence ENSEMBL: ENSMUSP00000070413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070070] [ENSMUST00000118771] [ENSMUST00000120452] [ENSMUST00000154690]
Predicted Effect probably benign
Transcript: ENSMUST00000070070
AA Change: I260T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285
AA Change: I260T

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118771
SMART Domains Protein: ENSMUSP00000112811
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120452
AA Change: I260T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285
AA Change: I260T

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154690
SMART Domains Protein: ENSMUSP00000119602
Gene: ENSMUSG00000032285

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
R2139:Dnaja4 UTSW 9 54709222 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R6985:Dnaja4 UTSW 9 54708395 missense probably benign 0.06
R7165:Dnaja4 UTSW 9 54709232 missense probably damaging 1.00
R7228:Dnaja4 UTSW 9 54714285 missense possibly damaging 0.88
R7762:Dnaja4 UTSW 9 54709210 missense probably benign 0.03
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCTAATGAGTTAAGACCCCTC -3'
(R):5'- TCCTGCTGAGACCATGCAAG -3'

Sequencing Primer
(F):5'- CCCCAAATTTCTGTCCCTTCAG -3'
(R):5'- TGCAAGCCAGCCACGATG -3'
Posted On2019-06-07