Incidental Mutation 'PIT4305001:Poc1a'
ID 554564
Institutional Source Beutler Lab
Gene Symbol Poc1a
Ensembl Gene ENSMUSG00000023345
Gene Name POC1 centriolar protein A
Synonyms Wdr51a, 2510040D07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106281061-106350521 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106349829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 420 (Q420R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072206] [ENSMUST00000191434] [ENSMUST00000214540] [ENSMUST00000216228] [ENSMUST00000217213]
AlphaFold Q8JZX3
Predicted Effect probably benign
Transcript: ENSMUST00000072206
SMART Domains Protein: ENSMUSP00000072064
Gene: ENSMUSG00000023345

DomainStartEndE-ValueType
WD40 8 47 1.76e-9 SMART
WD40 50 89 5.51e-11 SMART
WD40 92 131 2.45e-8 SMART
WD40 134 173 5.14e-11 SMART
WD40 176 215 5.06e-10 SMART
WD40 218 257 9.97e-9 SMART
WD40 260 299 2.67e-9 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 367 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191434
SMART Domains Protein: ENSMUSP00000140374
Gene: ENSMUSG00000023345

DomainStartEndE-ValueType
WD40 7 46 1.76e-9 SMART
WD40 49 88 5.51e-11 SMART
WD40 91 130 2.45e-8 SMART
WD40 133 172 5.14e-11 SMART
WD40 175 214 5.06e-10 SMART
WD40 217 256 9.97e-9 SMART
WD40 259 298 2.67e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214208
Predicted Effect probably benign
Transcript: ENSMUST00000214483
Predicted Effect probably benign
Transcript: ENSMUST00000214540
Predicted Effect probably benign
Transcript: ENSMUST00000216228
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000217213
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutations in this gene result in short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT) syndrome. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for this mutation exhibit disproportionate dwarfism and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Poc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Poc1a APN 9 106305304 missense probably benign 0.27
IGL02792:Poc1a APN 9 106295194 missense possibly damaging 0.75
IGL02936:Poc1a APN 9 106285027 missense probably damaging 1.00
R2154:Poc1a UTSW 9 106285574 critical splice donor site probably null
R4658:Poc1a UTSW 9 106349688 missense possibly damaging 0.95
R4811:Poc1a UTSW 9 106349709 missense probably damaging 0.96
R5058:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5059:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5060:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5461:Poc1a UTSW 9 106288010 missense probably damaging 1.00
R7592:Poc1a UTSW 9 106349768 missense probably benign 0.28
R8680:Poc1a UTSW 9 106349761 missense probably benign
R9122:Poc1a UTSW 9 106285043 missense probably benign 0.01
RF009:Poc1a UTSW 9 106295218 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATACTGACTCCTAGGGCAGC -3'
(R):5'- TTAAACTGCATGTGGCCCTGC -3'

Sequencing Primer
(F):5'- AGCGAGGCAGGCTTTCCATC -3'
(R):5'- GGGTCTCCAGTCTCCTTTTTGTG -3'
Posted On 2019-06-07