Incidental Mutation 'PIT4305001:Lum'
ID 554566
Institutional Source Beutler Lab
Gene Symbol Lum
Ensembl Gene ENSMUSG00000036446
Gene Name lumican
Synonyms Ldc, SLRR2D
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 97565128-97572703 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 97568876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 211 (Y211S)
Ref Sequence ENSEMBL: ENSMUSP00000040877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038160]
AlphaFold P51885
Predicted Effect probably damaging
Transcript: ENSMUST00000038160
AA Change: Y211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040877
Gene: ENSMUSG00000036446
AA Change: Y211S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 36 70 1.02e-10 SMART
LRR 66 88 2.14e1 SMART
LRR 89 114 1.92e2 SMART
LRR 135 157 1.67e2 SMART
LRR 158 181 7.8e1 SMART
LRR_TYP 183 206 2.36e-2 SMART
LRR 207 227 6.41e1 SMART
LRR 228 253 6.59e1 SMART
LRR 254 275 4.45e1 SMART
LRR 303 328 3.18e2 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene have abnormally large and aberrantly contoured collagen fibrils forming a disorganized matrix in the tendon, skin, cornea and sclera, with consequent reductions in skin tensile strength and corneal clarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Lum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Lum APN 10 97568685 missense probably damaging 1.00
IGL01394:Lum APN 10 97568972 missense probably damaging 1.00
IGL02160:Lum APN 10 97568581 missense probably damaging 0.96
IGL02659:Lum APN 10 97568747 missense probably benign
R0352:Lum UTSW 10 97568609 missense probably damaging 0.97
R0403:Lum UTSW 10 97572043 missense probably benign 0.05
R1446:Lum UTSW 10 97568390 missense possibly damaging 0.88
R2760:Lum UTSW 10 97568771 missense probably benign 0.16
R4154:Lum UTSW 10 97568953 missense probably damaging 1.00
R4492:Lum UTSW 10 97568438 missense probably damaging 1.00
R7601:Lum UTSW 10 97568306 missense probably damaging 1.00
R8058:Lum UTSW 10 97568563 missense probably benign 0.00
R8747:Lum UTSW 10 97568489 missense possibly damaging 0.88
R9334:Lum UTSW 10 97568485 missense probably damaging 1.00
R9360:Lum UTSW 10 97568890 nonsense probably null
R9800:Lum UTSW 10 97568295 missense probably benign 0.00
X0065:Lum UTSW 10 97568980 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATCAGCAAGCTCGGCTCC -3'
(R):5'- TCAAGTTCATTGACCTCCAGG -3'

Sequencing Primer
(F):5'- AAGCTCGGCTCCTTCGAC -3'
(R):5'- TTTCCAGGTACCCCACTA -3'
Posted On 2019-06-07