Incidental Mutation 'PIT4305001:Il9r'
ID 554568
Institutional Source Beutler Lab
Gene Symbol Il9r
Ensembl Gene ENSMUSG00000020279
Gene Name interleukin 9 receptor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4305001 (G1)
Quality Score 210.009
Status Not validated
Chromosome 11
Chromosomal Location 32187541-32200279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32194734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 53 (Q53L)
Ref Sequence ENSEMBL: ENSMUSP00000119185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020518] [ENSMUST00000128311] [ENSMUST00000142396] [ENSMUST00000145401]
AlphaFold Q01114
Predicted Effect probably benign
Transcript: ENSMUST00000020518
SMART Domains Protein: ENSMUSP00000020518
Gene: ENSMUSG00000020279

DomainStartEndE-ValueType
SCOP:d1gh7a2 47 98 1e-3 SMART
Blast:FN3 49 95 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128311
AA Change: Q48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119557
Gene: ENSMUSG00000020279
AA Change: Q48L

DomainStartEndE-ValueType
PDB:4GS7|B 48 254 5e-6 PDB
SCOP:d1gh7a2 143 257 4e-11 SMART
Blast:FN3 146 229 5e-43 BLAST
transmembrane domain 270 292 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142396
AA Change: Q53L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119185
Gene: ENSMUSG00000020279
AA Change: Q53L

DomainStartEndE-ValueType
PDB:4GS7|B 53 259 5e-6 PDB
SCOP:d1gh7a2 148 262 3e-11 SMART
Blast:FN3 151 234 5e-43 BLAST
transmembrane domain 275 297 N/A INTRINSIC
low complexity region 348 357 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145401
AA Change: Q48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118204
Gene: ENSMUSG00000020279
AA Change: Q48L

DomainStartEndE-ValueType
Blast:FN3 146 228 3e-42 BLAST
SCOP:d1egja_ 147 256 1e-10 SMART
transmembrane domain 269 291 N/A INTRINSIC
low complexity region 342 351 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more susceptible to experimental autoimmune encephalomyelitis, a defect partially attributable to defective regulatory T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Il9r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03267:Il9r APN 11 32191778 missense possibly damaging 0.76
PIT4651001:Il9r UTSW 11 32191798 missense probably benign 0.02
R1691:Il9r UTSW 11 32191829 missense possibly damaging 0.75
R1695:Il9r UTSW 11 32193227 missense probably benign 0.31
R4816:Il9r UTSW 11 32192654 missense possibly damaging 0.93
R5381:Il9r UTSW 11 32190715 missense probably benign 0.14
R5701:Il9r UTSW 11 32193263 missense probably benign 0.41
R6015:Il9r UTSW 11 32192674 missense probably benign 0.14
R6445:Il9r UTSW 11 32191000 missense possibly damaging 0.92
R6584:Il9r UTSW 11 32191782 missense probably benign 0.01
R6976:Il9r UTSW 11 32193177 nonsense probably null
R7171:Il9r UTSW 11 32192671 missense probably benign 0.15
R7326:Il9r UTSW 11 32194389 missense possibly damaging 0.78
R7948:Il9r UTSW 11 32194486 missense probably damaging 1.00
R9679:Il9r UTSW 11 32190853 missense probably benign 0.05
X0028:Il9r UTSW 11 32190793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCTGGTTACTGGGAAGG -3'
(R):5'- ACCCAGCAAAGCTCTTAGGTC -3'

Sequencing Primer
(F):5'- AAGGCCATGTGTTAGTGGCAC -3'
(R):5'- CAGCAAAGCTCTTAGGTCTGACTG -3'
Posted On 2019-06-07