Incidental Mutation 'PIT4305001:Akap1'
ID 554571
Institutional Source Beutler Lab
Gene Symbol Akap1
Ensembl Gene ENSMUSG00000018428
Gene Name A kinase (PRKA) anchor protein 1
Synonyms DAKAP1, AKAP84, S-AKAP84, AKAP121
Accession Numbers

Ncbi RefSeq: NM_001042541.1, NM_009648.2; MGI:104729

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 88830792-88864586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88844378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 486 (M486K)
Ref Sequence ENSEMBL: ENSMUSP00000103536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018572] [ENSMUST00000107903] [ENSMUST00000107904] [ENSMUST00000143720]
AlphaFold O08715
Predicted Effect probably benign
Transcript: ENSMUST00000018572
AA Change: M486K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018572
Gene: ENSMUSG00000018428
AA Change: M486K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107903
AA Change: M486K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103536
Gene: ENSMUSG00000018428
AA Change: M486K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107904
AA Change: M519K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103537
Gene: ENSMUSG00000018428
AA Change: M519K

DomainStartEndE-ValueType
transmembrane domain 40 59 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 482 495 N/A INTRINSIC
KH 593 663 1.59e-10 SMART
low complexity region 672 684 N/A INTRINSIC
TUDOR 743 802 5.32e-12 SMART
low complexity region 811 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143720
AA Change: M486K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122295
Gene: ENSMUSG00000018428
AA Change: M486K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:RII_binding_1 305 322 5.5e-5 PFAM
low complexity region 449 462 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123018
Gene: ENSMUSG00000018428
AA Change: M40K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype Strain: 3620561
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit reduced female fertility and impaired oocyte maturation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(3) Gene trapped(46)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Akap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Akap1 APN 11 88844254 splice site probably null
IGL01333:Akap1 APN 11 88845605 missense probably damaging 0.99
IGL01701:Akap1 APN 11 88845132 missense probably benign 0.03
IGL01920:Akap1 APN 11 88839633 missense probably damaging 1.00
IGL02980:Akap1 UTSW 11 88845164 missense probably benign
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0278:Akap1 UTSW 11 88845194 missense probably benign 0.19
R1437:Akap1 UTSW 11 88844751 nonsense probably null
R1438:Akap1 UTSW 11 88844751 nonsense probably null
R1439:Akap1 UTSW 11 88844751 nonsense probably null
R1569:Akap1 UTSW 11 88833180 missense probably benign 0.02
R1611:Akap1 UTSW 11 88845278 missense probably benign 0.27
R1757:Akap1 UTSW 11 88845752 missense probably damaging 1.00
R2328:Akap1 UTSW 11 88845044 missense possibly damaging 0.46
R2897:Akap1 UTSW 11 88844779 nonsense probably null
R3730:Akap1 UTSW 11 88845182 missense possibly damaging 0.82
R4868:Akap1 UTSW 11 88844553 missense possibly damaging 0.83
R5620:Akap1 UTSW 11 88845517 missense possibly damaging 0.82
R5645:Akap1 UTSW 11 88845627 missense probably benign 0.01
R5886:Akap1 UTSW 11 88834660 critical splice donor site probably null
R5932:Akap1 UTSW 11 88831759 missense probably damaging 1.00
R6284:Akap1 UTSW 11 88844568 missense possibly damaging 0.66
R6555:Akap1 UTSW 11 88844882 missense probably damaging 1.00
R7234:Akap1 UTSW 11 88838982 missense probably damaging 1.00
R7436:Akap1 UTSW 11 88845528 missense probably damaging 1.00
R7759:Akap1 UTSW 11 88845833 missense probably damaging 1.00
R8356:Akap1 UTSW 11 88834731 critical splice acceptor site probably null
R8456:Akap1 UTSW 11 88834731 critical splice acceptor site probably null
R8796:Akap1 UTSW 11 88839672 missense probably damaging 1.00
R8948:Akap1 UTSW 11 88844273 missense probably damaging 1.00
R9006:Akap1 UTSW 11 88833170 missense possibly damaging 0.83
R9116:Akap1 UTSW 11 88832339 missense probably damaging 1.00
R9174:Akap1 UTSW 11 88835165 missense probably damaging 1.00
R9294:Akap1 UTSW 11 88837140 missense probably damaging 1.00
Z1176:Akap1 UTSW 11 88837167 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCAAATAATGGGACCCCTC -3'
(R):5'- TGCACATCACATCTCCCTGG -3'

Sequencing Primer
(F):5'- GGACCCCTCCCAGATTCATC -3'
(R):5'- AGGCAGTCTCTGGAGGG -3'
Posted On 2019-06-07