Incidental Mutation 'PIT4305001:Serpina12'
ID 554574
Institutional Source Beutler Lab
Gene Symbol Serpina12
Ensembl Gene ENSMUSG00000041567
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms vaspin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 104028769-104044443 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104035717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 247 (Y247H)
Ref Sequence ENSEMBL: ENSMUSP00000045572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043915]
AlphaFold Q7TMF5
Predicted Effect probably damaging
Transcript: ENSMUST00000043915
AA Change: Y247H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: Y247H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 57 411 1.02e-139 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Serpina12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Serpina12 APN 12 104031114 missense probably benign 0.01
IGL00976:Serpina12 APN 12 104032528 missense probably damaging 1.00
IGL01592:Serpina12 APN 12 104038122 missense probably damaging 1.00
IGL02355:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02362:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02648:Serpina12 APN 12 104038008 missense probably benign 0.02
IGL03011:Serpina12 APN 12 104031138 missense possibly damaging 0.86
IGL03156:Serpina12 APN 12 104037899 missense probably damaging 1.00
sabina UTSW 12 104037920 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0448:Serpina12 UTSW 12 104038095 missense probably benign 0.20
R0465:Serpina12 UTSW 12 104037845 missense probably benign 0.04
R0480:Serpina12 UTSW 12 104035701 missense probably damaging 1.00
R0498:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R0503:Serpina12 UTSW 12 104031159 missense probably damaging 0.97
R0581:Serpina12 UTSW 12 104031140 missense probably damaging 0.97
R1393:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R1847:Serpina12 UTSW 12 104032510 missense probably damaging 1.00
R1956:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R3125:Serpina12 UTSW 12 104037983 missense probably benign
R4093:Serpina12 UTSW 12 104037924 missense probably damaging 1.00
R4584:Serpina12 UTSW 12 104038352 missense unknown
R4897:Serpina12 UTSW 12 104037797 missense possibly damaging 0.60
R5117:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R5167:Serpina12 UTSW 12 104037920 missense probably damaging 1.00
R5344:Serpina12 UTSW 12 104035548 splice site probably null
R5720:Serpina12 UTSW 12 104038304 missense probably benign 0.05
R6011:Serpina12 UTSW 12 104035734 missense probably damaging 1.00
R6027:Serpina12 UTSW 12 104031077 missense probably benign 0.01
R6170:Serpina12 UTSW 12 104038241 missense probably benign 0.03
R7538:Serpina12 UTSW 12 104038328 missense unknown
R7899:Serpina12 UTSW 12 104038265 missense probably benign 0.01
R9649:Serpina12 UTSW 12 104038058 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTGTGGACAAAGCTCTG -3'
(R):5'- CATCACTGCCCCTGAATCTG -3'

Sequencing Primer
(F):5'- GTGGACAAAGCTCTGACTTTACC -3'
(R):5'- TGCCCCTGAATCTGGTGGAC -3'
Posted On 2019-06-07