Incidental Mutation 'R0601:Kcnh8'
ID55458
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 038790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0601 (G1)
Quality Score190
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52894005 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: D489G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: D489G

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.4179 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,810,189 D143A probably damaging Het
Abca9 C T 11: 110,117,058 probably null Het
Abcc5 A G 16: 20,404,559 probably benign Het
Ablim3 T A 18: 61,849,370 D168V probably benign Het
Acsl3 C T 1: 78,696,179 S352F probably damaging Het
Adgrl4 A T 3: 151,498,429 probably benign Het
Arhgap29 A G 3: 121,991,110 K229E probably damaging Het
Atad3a A T 4: 155,747,407 V470D probably damaging Het
Atp8b1 A G 18: 64,571,653 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bpifa5 A G 2: 154,164,255 N121S possibly damaging Het
Bpifb4 G A 2: 153,947,283 probably benign Het
Bptf T A 11: 107,061,692 T2112S probably benign Het
Btnl4 T C 17: 34,469,311 K498E probably benign Het
Calhm2 A G 19: 47,141,030 probably null Het
Capn3 A T 2: 120,502,596 probably null Het
Caps2 T C 10: 112,195,790 F265L possibly damaging Het
Casp3 G T 8: 46,636,227 C170F probably benign Het
Ccdc39 T C 3: 33,819,839 R615G probably damaging Het
Cd177 A G 7: 24,752,313 I426T probably benign Het
Cfap53 G A 18: 74,300,150 R102H possibly damaging Het
Cfhr3 G A 1: 139,593,885 noncoding transcript Het
Col7a1 T C 9: 108,980,584 probably benign Het
Cplx3 T C 9: 57,606,074 E24G possibly damaging Het
D11Wsu47e T A 11: 113,687,886 S36T probably benign Het
Dhx30 A G 9: 110,086,714 probably null Het
Dnah8 T A 17: 30,708,358 N1329K probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dok3 A T 13: 55,524,263 F201I probably benign Het
Dpf2 A T 19: 5,902,212 H303Q probably damaging Het
Dtnb A G 12: 3,735,039 probably benign Het
Elk3 T C 10: 93,265,481 E136G probably damaging Het
Ephb1 T C 9: 102,195,130 D150G probably damaging Het
Erbb3 A G 10: 128,577,012 S570P probably benign Het
F2 A T 2: 91,633,311 probably null Het
Fanca A T 8: 123,308,513 M231K probably damaging Het
Fbxo34 T C 14: 47,530,257 V358A probably benign Het
Foxp1 C T 6: 98,930,122 E666K probably damaging Het
Fto A G 8: 91,401,802 probably null Het
Gbp2 C T 3: 142,630,758 R290C possibly damaging Het
Grik2 T G 10: 49,422,597 S343R probably damaging Het
Heatr5b A T 17: 78,768,545 M1448K probably benign Het
Hmgn3 A T 9: 83,146,429 probably null Het
Htt T C 5: 34,846,003 V1274A probably benign Het
Kcnip3 A T 2: 127,458,397 probably benign Het
Kdm5a A G 6: 120,402,671 T647A possibly damaging Het
Krt72 T C 15: 101,786,056 R135G probably damaging Het
Larp7 T A 3: 127,544,209 K400N probably damaging Het
Lifr T C 15: 7,169,272 probably null Het
Lima1 G A 15: 99,780,472 P696L probably damaging Het
Lrrc8e T G 8: 4,235,239 probably null Het
Map1a A G 2: 121,298,602 R116G probably damaging Het
Map3k13 A G 16: 21,905,249 E327G possibly damaging Het
Med13 A G 11: 86,345,962 V123A possibly damaging Het
Megf8 A C 7: 25,328,540 H205P probably benign Het
Met G A 6: 17,555,632 probably null Het
Mfsd14b A C 13: 65,087,150 V71G possibly damaging Het
Mpl T A 4: 118,443,536 T599S probably benign Het
Myh15 A T 16: 49,061,581 D62V probably damaging Het
Myo5a A G 9: 75,174,015 T961A probably benign Het
Myrfl A G 10: 116,776,760 Y895H probably damaging Het
Nap1l1 T C 10: 111,490,363 probably benign Het
Ncapd3 T A 9: 27,041,507 Y111N probably benign Het
Nlrc3 A G 16: 3,948,249 probably benign Het
Nsun2 G T 13: 69,633,242 V657L probably benign Het
Olfr1026 A T 2: 85,923,378 I37F probably benign Het
Olfr1247 T A 2: 89,609,220 N294I probably benign Het
Olfr142 T C 2: 90,252,934 D18G probably benign Het
Olfr1511 C A 14: 52,389,826 G316* probably null Het
Olfr195 G A 16: 59,149,754 M301I probably benign Het
Olfr596 T C 7: 103,310,164 S148P probably damaging Het
Olfr646 A T 7: 104,107,142 I288F possibly damaging Het
Olfr780 T A 10: 129,322,016 M131K possibly damaging Het
Osbpl3 A T 6: 50,299,403 V795D probably benign Het
Osbpl5 T C 7: 143,709,549 D155G probably damaging Het
Parm1 G A 5: 91,594,264 V164I probably benign Het
Pgd A T 4: 149,156,810 probably benign Het
Pkp1 G A 1: 135,878,182 R593W probably damaging Het
Polr2l A T 7: 141,473,342 V53E probably damaging Het
Ppp4c G T 7: 126,787,288 T29K probably benign Het
Ppp4r4 T A 12: 103,600,520 probably benign Het
Ptprd A G 4: 76,100,474 S688P probably benign Het
Rab3b A T 4: 108,890,389 I28F probably damaging Het
Rnase4 T C 14: 51,105,095 L92P probably benign Het
Rnpc3 T C 3: 113,620,106 E229G probably benign Het
Rtraf A T 14: 19,816,206 D147E possibly damaging Het
Rttn G A 18: 89,042,966 G1086D probably benign Het
Ryr2 A G 13: 11,705,633 probably null Het
Sft2d2 T C 1: 165,183,861 I126V probably benign Het
Skap1 G T 11: 96,723,410 probably benign Het
Slc14a2 A T 18: 78,157,179 L753* probably null Het
Slc25a5 G A X: 36,795,755 A9T probably benign Het
Slc30a5 T C 13: 100,814,770 probably benign Het
Slc5a4b A C 10: 76,064,036 I456S possibly damaging Het
Slc9a4 A T 1: 40,603,070 S400C probably damaging Het
Slx1b T A 7: 126,692,640 H84L probably damaging Het
Sptbn1 T C 11: 30,150,008 Y190C probably damaging Het
Stk32b T C 5: 37,531,566 Q138R probably damaging Het
Syt6 C A 3: 103,620,890 D308E probably damaging Het
Sytl2 G A 7: 90,395,166 D572N probably damaging Het
Taok2 A T 7: 126,879,433 L109Q probably damaging Het
Tbl1xr1 T C 3: 22,179,319 probably benign Het
Tlk1 A G 2: 70,714,158 I711T probably benign Het
Trf A G 9: 103,222,933 probably null Het
Trpc2 A G 7: 102,084,365 T548A possibly damaging Het
Ttbk2 A T 2: 120,825,296 I29N possibly damaging Het
Tti1 A T 2: 157,993,372 C989S probably damaging Het
Txndc8 A G 4: 58,000,256 Y108H probably benign Het
Ugt2b1 A T 5: 86,917,680 V500D possibly damaging Het
Vmn1r34 A G 6: 66,637,664 I30T possibly damaging Het
Vmn2r115 A G 17: 23,360,100 K849R probably null Het
Vmn2r76 T A 7: 86,226,115 probably null Het
Vps13c T A 9: 67,927,472 S1694R probably benign Het
Wdfy3 G T 5: 101,836,172 P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wdr60 T C 12: 116,255,935 D129G possibly damaging Het
Wnt8b T A 19: 44,493,667 W40R probably benign Het
Xrra1 A G 7: 99,910,968 I384V possibly damaging Het
Zfp11 A T 5: 129,657,907 H163Q probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGGTTGTATCCATATGCTCCTAGC -3'
(R):5'- GGTAACACTGTACCTGTCTTATGCCTG -3'

Sequencing Primer
(F):5'- TCCATATGCTCCTAGCAATGGAATC -3'
(R):5'- ACCTGTCTTATGCCTGTATTAGAAC -3'
Posted On2013-07-11