Incidental Mutation 'PIT4305001:Celsr1'
ID 554583
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
Accession Numbers
Essential gene? Possibly essential (E-score: 0.634) question?
Stock # PIT4305001 (G1)
Quality Score 188.009
Status Not validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85785138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 3032 (E3032V)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: E3032V

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: E3032V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023019
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162339
SMART Domains Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 1 46 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226204
Predicted Effect
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,086,610 (GRCm39) N801D probably benign Het
Adcy2 T C 13: 68,826,721 (GRCm39) K661R probably benign Het
Akap1 A T 11: 88,735,204 (GRCm39) M486K probably benign Het
Arhgap40 T A 2: 158,373,825 (GRCm39) I202N probably benign Het
C1qtnf2 T A 11: 43,382,022 (GRCm39) L248Q probably damaging Het
Casp1 A T 9: 5,306,135 (GRCm39) H340L probably benign Het
Cd5 A G 19: 10,703,750 (GRCm39) V104A possibly damaging Het
Cts7 A G 13: 61,504,386 (GRCm39) I59T probably damaging Het
Cutc G T 19: 43,756,708 (GRCm39) A267S probably damaging Het
Dmwd A G 7: 18,814,643 (GRCm39) Q431R probably damaging Het
Dnah6 T C 6: 73,042,738 (GRCm39) N3280S probably benign Het
Dnah7b A T 1: 46,412,508 (GRCm39) N4039I probably damaging Het
Dnaja4 T C 9: 54,617,918 (GRCm39) I260T probably benign Het
Drd5 T C 5: 38,477,927 (GRCm39) F307L probably damaging Het
Dsc2 C T 18: 20,179,300 (GRCm39) S256N probably damaging Het
Dstyk G T 1: 132,383,634 (GRCm39) E617* probably null Het
Dusp15 G A 2: 152,787,396 (GRCm39) H72Y probably benign Het
Dysf C T 6: 84,077,216 (GRCm39) R660* probably null Het
Fbxl13 T A 5: 21,727,146 (GRCm39) I584L probably benign Het
Gsap T C 5: 21,391,407 (GRCm39) L16P probably damaging Het
Hgsnat C T 8: 26,435,227 (GRCm39) A636T possibly damaging Het
Hivep1 A G 13: 42,335,147 (GRCm39) T161A Het
Hspg2 T C 4: 137,277,684 (GRCm39) S2928P possibly damaging Het
Ifi214 G A 1: 173,355,485 (GRCm39) P108S probably benign Het
Il17ra A T 6: 120,458,367 (GRCm39) Y506F probably damaging Het
Il9r T A 11: 32,144,734 (GRCm39) Q53L probably benign Het
Irf2bp2 C T 8: 127,319,398 (GRCm39) G260R probably damaging Het
Jdp2 T A 12: 85,685,626 (GRCm39) I129N probably damaging Het
Kif1b T C 4: 149,305,249 (GRCm39) probably null Het
Klrd1 A G 6: 129,573,670 (GRCm39) T120A unknown Het
Lfng A G 5: 140,598,283 (GRCm39) N202D probably damaging Het
Ltbp3 A G 19: 5,802,095 (GRCm39) E757G probably damaging Het
Ltn1 G A 16: 87,217,211 (GRCm39) P342L probably damaging Het
Lum A C 10: 97,404,738 (GRCm39) Y211S probably damaging Het
Ncapd2 G A 6: 125,160,990 (GRCm39) R292* probably null Het
Nlrc4 T C 17: 74,753,304 (GRCm39) T360A probably damaging Het
Or4c1 T C 2: 89,133,727 (GRCm39) I70V probably benign Het
Or7g32 T C 9: 19,389,357 (GRCm39) Y63C probably damaging Het
Pakap C A 4: 57,638,029 (GRCm39) T22K possibly damaging Het
Pde3a A G 6: 141,438,036 (GRCm39) D1035G probably benign Het
Phf20l1 A T 15: 66,484,901 (GRCm39) K322I possibly damaging Het
Pik3r3 A C 4: 116,149,323 (GRCm39) N349T probably benign Het
Poc1a A G 9: 106,227,028 (GRCm39) Q420R Het
Prl7d1 A T 13: 27,898,320 (GRCm39) M63K possibly damaging Het
Rap1gds1 C A 3: 138,662,061 (GRCm39) M398I probably benign Het
Rapgef6 T A 11: 54,570,203 (GRCm39) V1192D probably damaging Het
Rif1 T C 2: 52,001,970 (GRCm39) V166A Het
Robo4 T C 9: 37,322,687 (GRCm39) Y847H probably damaging Het
Sardh T C 2: 27,118,326 (GRCm39) N468S probably damaging Het
Sema5a A G 15: 32,628,345 (GRCm39) T553A probably benign Het
Serpina12 A G 12: 104,001,976 (GRCm39) Y247H probably damaging Het
Speer4e2 T C 5: 15,028,804 (GRCm39) D29G probably benign Het
Ston2 G T 12: 91,615,276 (GRCm39) D377E possibly damaging Het
Syne1 A G 10: 5,283,023 (GRCm39) S1557P probably damaging Het
Syt6 C T 3: 103,482,769 (GRCm39) R26W possibly damaging Het
Tep1 C T 14: 51,066,684 (GRCm39) G2305R possibly damaging Het
Ticrr A G 7: 79,328,771 (GRCm39) T637A possibly damaging Het
Tnn A T 1: 159,913,647 (GRCm39) F1546Y possibly damaging Het
Tpr A G 1: 150,315,888 (GRCm39) D2055G possibly damaging Het
Trim39 A G 17: 36,579,862 (GRCm39) V31A possibly damaging Het
Trpc7 G T 13: 57,035,321 (GRCm39) T204K probably benign Het
Urgcp T C 11: 5,667,996 (GRCm39) Y157C probably damaging Het
Vmn1r81 A T 7: 11,994,590 (GRCm39) I6K probably benign Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1795:Celsr1 UTSW 15 85,914,524 (GRCm39) missense probably damaging 0.99
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2131:Celsr1 UTSW 15 85,847,424 (GRCm39) missense probably benign 0.35
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85,822,112 (GRCm39) missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,914,550 (GRCm39) missense probably damaging 0.96
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7741:Celsr1 UTSW 15 85,863,303 (GRCm39) missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCATGGTTTCCTGATGG -3'
(R):5'- TGGCTGATTGTGAGCAGAGC -3'

Sequencing Primer
(F):5'- GAAGTTTCATTACTGCCTCTGTG -3'
(R):5'- TGATTGTGAGCAGAGCCCCAC -3'
Posted On 2019-06-07