Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Celsr1'

554583

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

PIT4305001 (G1)

Quality Score

188.009

Status

Not validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85900937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 3032 (E3032V)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016172
AA Change: E3032V

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: E3032V

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000023019

SMART Domains

Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386

Domain	Start	End	E-Value	Type
Pfam:NAD_synthase	1	133	7.7e-7	PFAM
Pfam:ThiI	3	79	7.7e-8	PFAM
Pfam:tRNA_Me_trans	5	383	3.4e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162339

SMART Domains

Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

Domain	Start	End	E-Value	Type
Pfam:tRNA_Me_trans	1	46	1.1e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226204

Predicted Effect

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041 (GRCm38)	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602 (GRCm38)	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378 (GRCm38)	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905 (GRCm38)	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195 (GRCm38)	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135 (GRCm38)	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386 (GRCm38)	V104A	possibly damaging	Het
Cts7	A	G	13: 61,356,572 (GRCm38)	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269 (GRCm38)	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718 (GRCm38)	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755 (GRCm38)	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348 (GRCm38)	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634 (GRCm38)	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584 (GRCm38)	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243 (GRCm38)	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896 (GRCm38)	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476 (GRCm38)	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234 (GRCm38)	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148 (GRCm38)	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790 (GRCm38)	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409 (GRCm38)	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199 (GRCm38)	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671 (GRCm38)	T161A		Het
Hspg2	T	C	4: 137,550,373 (GRCm38)	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919 (GRCm38)	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406 (GRCm38)	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734 (GRCm38)	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659 (GRCm38)	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852 (GRCm38)	I129N	probably damaging	Het
Kif1b	T	C	4: 149,220,792 (GRCm38)		probably null	Het
Klrd1	A	G	6: 129,596,707 (GRCm38)	T120A	unknown	Het
Lfng	A	G	5: 140,612,528 (GRCm38)	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067 (GRCm38)	E757G	probably damaging	Het
Ltn1	G	A	16: 87,420,323 (GRCm38)	P342L	probably damaging	Het
Lum	A	C	10: 97,568,876 (GRCm38)	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027 (GRCm38)	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309 (GRCm38)	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383 (GRCm38)	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061 (GRCm38)	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029 (GRCm38)	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310 (GRCm38)	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052 (GRCm38)	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126 (GRCm38)	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829 (GRCm38)	Q420R		Het
Prl7d1	A	T	13: 27,714,337 (GRCm38)	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300 (GRCm38)	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377 (GRCm38)	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958 (GRCm38)	V166A		Het
Robo4	T	C	9: 37,411,391 (GRCm38)	Y847H	probably damaging	Het
Sardh	T	C	2: 27,228,314 (GRCm38)	N468S	probably damaging	Het
Sema5a	A	G	15: 32,628,199 (GRCm38)	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717 (GRCm38)	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502 (GRCm38)	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023 (GRCm38)	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453 (GRCm38)	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227 (GRCm38)	G2305R	possibly damaging	Het
Ticrr	A	G	7: 79,679,023 (GRCm38)	T637A	possibly damaging	Het
Tnn	A	T	1: 160,086,077 (GRCm38)	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137 (GRCm38)	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970 (GRCm38)	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508 (GRCm38)	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996 (GRCm38)	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663 (GRCm38)	I6K	probably benign	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85,931,345 (GRCm38)	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86,030,836 (GRCm38)	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85,922,235 (GRCm38)	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86,030,491 (GRCm38)	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85,926,190 (GRCm38)	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85,929,895 (GRCm38)	missense	probably benign
IGL01931:Celsr1	APN	15	85,907,660 (GRCm38)	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85,963,223 (GRCm38)	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85,907,721 (GRCm38)	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85,979,004 (GRCm38)	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85,929,907 (GRCm38)	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86,031,226 (GRCm38)	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85,941,136 (GRCm38)	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85,900,688 (GRCm38)	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86,030,617 (GRCm38)	nonsense	probably null
IGL02899:Celsr1	APN	15	86,031,726 (GRCm38)	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85,901,472 (GRCm38)	missense	probably benign
IGL03212:Celsr1	APN	15	85,930,677 (GRCm38)	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85,922,235 (GRCm38)	missense	probably damaging	1.00
PIT4480001:Celsr1	UTSW	15	86,032,414 (GRCm38)	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86,031,042 (GRCm38)	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86,031,042 (GRCm38)	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85,929,419 (GRCm38)	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86,030,762 (GRCm38)	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85,922,198 (GRCm38)	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85,922,198 (GRCm38)	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85,902,864 (GRCm38)	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85,903,365 (GRCm38)	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85,932,323 (GRCm38)	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85,901,597 (GRCm38)	missense	probably benign
R0792:Celsr1	UTSW	15	85,931,276 (GRCm38)	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85,903,288 (GRCm38)	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86,031,279 (GRCm38)	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86,032,047 (GRCm38)	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85,903,974 (GRCm38)	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85,979,146 (GRCm38)	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85,905,434 (GRCm38)	splice site	probably null
R1405:Celsr1	UTSW	15	85,905,434 (GRCm38)	splice site	probably null
R1522:Celsr1	UTSW	15	85,931,276 (GRCm38)	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86,031,062 (GRCm38)	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85,932,457 (GRCm38)	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86,030,323 (GRCm38)	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86,032,685 (GRCm38)	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86,032,759 (GRCm38)	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86,032,887 (GRCm38)	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86,030,547 (GRCm38)	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85,963,223 (GRCm38)	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86,031,967 (GRCm38)	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85,979,230 (GRCm38)	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85,916,723 (GRCm38)	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86,031,807 (GRCm38)	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85,978,827 (GRCm38)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,927,999 (GRCm38)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,963,133 (GRCm38)	missense	probably benign	0.00
R4416:Celsr1	UTSW	15	85,927,999 (GRCm38)	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85,916,756 (GRCm38)	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86,030,494 (GRCm38)	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85,932,460 (GRCm38)	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85,906,029 (GRCm38)	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85,937,953 (GRCm38)	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85,937,911 (GRCm38)	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85,939,134 (GRCm38)	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85,932,384 (GRCm38)	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85,930,546 (GRCm38)	missense	probably benign
R5310:Celsr1	UTSW	15	85,926,222 (GRCm38)	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85,925,518 (GRCm38)	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85,931,282 (GRCm38)	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86,030,767 (GRCm38)	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85,941,264 (GRCm38)	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86,032,955 (GRCm38)	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85,904,014 (GRCm38)	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	86,030,349 (GRCm38)	missense	probably damaging	0.96
R5915:Celsr1	UTSW	15	85,937,975 (GRCm38)	missense	probably benign
R5932:Celsr1	UTSW	15	86,032,704 (GRCm38)	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86,032,500 (GRCm38)	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85,919,038 (GRCm38)	splice site	probably null
R6050:Celsr1	UTSW	15	85,930,611 (GRCm38)	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85,932,411 (GRCm38)	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85,901,021 (GRCm38)	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85,921,193 (GRCm38)	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85,916,687 (GRCm38)	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85,928,330 (GRCm38)	missense	probably benign
R6320:Celsr1	UTSW	15	85,900,959 (GRCm38)	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86,031,684 (GRCm38)	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85,925,518 (GRCm38)	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85,978,920 (GRCm38)	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85,963,285 (GRCm38)	missense	probably benign
R6615:Celsr1	UTSW	15	85,902,114 (GRCm38)	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85,918,934 (GRCm38)	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85,905,914 (GRCm38)	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85,907,598 (GRCm38)	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86,031,495 (GRCm38)	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86,030,782 (GRCm38)	missense	probably benign
R6838:Celsr1	UTSW	15	85,939,194 (GRCm38)	missense	probably benign
R6886:Celsr1	UTSW	15	86,031,654 (GRCm38)	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85,905,478 (GRCm38)	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86,032,655 (GRCm38)	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85,932,451 (GRCm38)	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86,033,008 (GRCm38)	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86,030,514 (GRCm38)	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86,030,674 (GRCm38)	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85,907,673 (GRCm38)	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86,033,392 (GRCm38)	missense	probably benign
R7491:Celsr1	UTSW	15	86,032,518 (GRCm38)	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85,929,872 (GRCm38)	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85,978,732 (GRCm38)	nonsense	probably null
R7741:Celsr1	UTSW	15	85,979,102 (GRCm38)	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85,932,409 (GRCm38)	missense	probably benign
R7974:Celsr1	UTSW	15	86,031,030 (GRCm38)	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86,032,993 (GRCm38)	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86,032,993 (GRCm38)	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85,939,155 (GRCm38)	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86,031,600 (GRCm38)	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85,902,889 (GRCm38)	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85,979,235 (GRCm38)	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8290:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8292:Celsr1	UTSW	15	85,907,618 (GRCm38)	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85,922,244 (GRCm38)	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85,932,300 (GRCm38)	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86,031,414 (GRCm38)	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8384:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8452:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8463:Celsr1	UTSW	15	86,030,214 (GRCm38)	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8480:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8493:Celsr1	UTSW	15	85,938,006 (GRCm38)	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85,939,105 (GRCm38)	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R8771:Celsr1	UTSW	15	85,903,974 (GRCm38)	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85,937,993 (GRCm38)	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85,904,068 (GRCm38)	intron	probably benign
R8924:Celsr1	UTSW	15	86,032,470 (GRCm38)	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85,963,139 (GRCm38)	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86,030,571 (GRCm38)	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85,919,016 (GRCm38)	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9196:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9198:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9200:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9201:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9202:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9203:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9222:Celsr1	UTSW	15	85,931,270 (GRCm38)	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86,030,850 (GRCm38)	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9386:Celsr1	UTSW	15	85,979,030 (GRCm38)	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9401:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9415:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9428:Celsr1	UTSW	15	85,931,348 (GRCm38)	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85,922,334 (GRCm38)	splice site	probably benign
R9493:Celsr1	UTSW	15	85,901,145 (GRCm38)	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9499:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
R9607:Celsr1	UTSW	15	86,031,028 (GRCm38)	missense
R9673:Celsr1	UTSW	15	86,033,085 (GRCm38)	nonsense	probably null
Z1176:Celsr1	UTSW	15	85,963,100 (GRCm38)	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85,978,851 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTCATGGTTTCCTGATGG -3'
(R):5'- TGGCTGATTGTGAGCAGAGC -3'

Sequencing Primer
(F):5'- GAAGTTTCATTACTGCCTCTGTG -3'
(R):5'- TGATTGTGAGCAGAGCCCCAC -3'

Posted On

2019-06-07