Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4305001:Ltn1'

554584

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4305001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87420323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 342 (P342L)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]

AlphaFold

Q6A009

Predicted Effect

probably damaging
Transcript: ENSMUST00000039449
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: P342L

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232095
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.4%
3x: 91.3%
10x: 86.8%
20x: 76.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts4	A	G	1: 171,259,041	N801D	probably benign	Het
Adcy2	T	C	13: 68,678,602	K661R	probably benign	Het
Akap1	A	T	11: 88,844,378	M486K	probably benign	Het
Arhgap40	T	A	2: 158,531,905	I202N	probably benign	Het
C1qtnf2	T	A	11: 43,491,195	L248Q	probably damaging	Het
Casp1	A	T	9: 5,306,135	H340L	probably benign	Het
Cd5	A	G	19: 10,726,386	V104A	possibly damaging	Het
Celsr1	T	A	15: 85,900,937	E3032V	possibly damaging	Het
Cts7	A	G	13: 61,356,572	I59T	probably damaging	Het
Cutc	G	T	19: 43,768,269	A267S	probably damaging	Het
Dmwd	A	G	7: 19,080,718	Q431R	probably damaging	Het
Dnah6	T	C	6: 73,065,755	N3280S	probably benign	Het
Dnah7b	A	T	1: 46,373,348	N4039I	probably damaging	Het
Dnaja4	T	C	9: 54,710,634	I260T	probably benign	Het
Drd5	T	C	5: 38,320,584	F307L	probably damaging	Het
Dsc2	C	T	18: 20,046,243	S256N	probably damaging	Het
Dstyk	G	T	1: 132,455,896	E617*	probably null	Het
Dusp15	G	A	2: 152,945,476	H72Y	probably benign	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Fbxl13	T	A	5: 21,522,148	I584L	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Gsap	T	C	5: 21,186,409	L16P	probably damaging	Het
Hgsnat	C	T	8: 25,945,199	A636T	possibly damaging	Het
Hivep1	A	G	13: 42,181,671	T161A		Het
Hspg2	T	C	4: 137,550,373	S2928P	possibly damaging	Het
Ifi214	G	A	1: 173,527,919	P108S	probably benign	Het
Il17ra	A	T	6: 120,481,406	Y506F	probably damaging	Het
Il9r	T	A	11: 32,194,734	Q53L	probably benign	Het
Irf2bp2	C	T	8: 126,592,659	G260R	probably damaging	Het
Jdp2	T	A	12: 85,638,852	I129N	probably damaging	Het
Kif1b	T	C	4: 149,220,792		probably null	Het
Klrd1	A	G	6: 129,596,707	T120A	unknown	Het
Lfng	A	G	5: 140,612,528	N202D	probably damaging	Het
Ltbp3	A	G	19: 5,752,067	E757G	probably damaging	Het
Lum	A	C	10: 97,568,876	Y211S	probably damaging	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Nlrc4	T	C	17: 74,446,309	T360A	probably damaging	Het
Olfr1231	T	C	2: 89,303,383	I70V	probably benign	Het
Olfr850	T	C	9: 19,478,061	Y63C	probably damaging	Het
Palm2	C	A	4: 57,638,029	T22K	possibly damaging	Het
Pde3a	A	G	6: 141,492,310	D1035G	probably benign	Het
Phf20l1	A	T	15: 66,613,052	K322I	possibly damaging	Het
Pik3r3	A	C	4: 116,292,126	N349T	probably benign	Het
Poc1a	A	G	9: 106,349,829	Q420R		Het
Prl7d1	A	T	13: 27,714,337	M63K	possibly damaging	Het
Rap1gds1	C	A	3: 138,956,300	M398I	probably benign	Het
Rapgef6	T	A	11: 54,679,377	V1192D	probably damaging	Het
Rif1	T	C	2: 52,111,958	V166A		Het
Robo4	T	C	9: 37,411,391	Y847H	probably damaging	Het
Sardh	T	C	2: 27,228,314	N468S	probably damaging	Het
Sema5a	A	G	15: 32,628,199	T553A	probably benign	Het
Serpina12	A	G	12: 104,035,717	Y247H	probably damaging	Het
Ston2	G	T	12: 91,648,502	D377E	possibly damaging	Het
Syne1	A	G	10: 5,333,023	S1557P	probably damaging	Het
Syt6	C	T	3: 103,575,453	R26W	possibly damaging	Het
Tep1	C	T	14: 50,829,227	G2305R	possibly damaging	Het
Ticrr	A	G	7: 79,679,023	T637A	possibly damaging	Het
Tnn	A	T	1: 160,086,077	F1546Y	possibly damaging	Het
Tpr	A	G	1: 150,440,137	D2055G	possibly damaging	Het
Trim39	A	G	17: 36,268,970	V31A	possibly damaging	Het
Trpc7	G	T	13: 56,887,508	T204K	probably benign	Het
Urgcp	T	C	11: 5,717,996	Y157C	probably damaging	Het
Vmn1r81	A	T	7: 12,260,663	I6K	probably benign	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAAATGTATTTGCTCACCCGG -3'
(R):5'- TGTCCTGTCTAATAAAACTCACTGG -3'

Sequencing Primer
(F):5'- TTTGCTCACCCGGTAACTAGAGAG -3'
(R):5'- GAACTCTGTACCTTCGGAAGTCAG -3'

Posted On

2019-06-07