Incidental Mutation 'PIT4305001:Dsc2'
ID554587
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4305001 (G1)
Quality Score196.009
Status Not validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20046243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 256 (S256N)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: S256N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: S256N

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: S256N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: S256N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACAGATAACCCATTGGCTGG -3'
(R):5'- ACATCTGGCTATGCATTTGTTTGTC -3'

Sequencing Primer
(F):5'- TTGGCTGGATAAGAAACTAAGAAACC -3'
(R):5'- CATGCTTGACCCATGTGAGAAACTG -3'
Posted On2019-06-07