Incidental Mutation 'PIT4305001:Cd5'
ID 554589
Institutional Source Beutler Lab
Gene Symbol Cd5
Ensembl Gene ENSMUSG00000024669
Gene Name CD5 antigen
Synonyms Lyt-1, Ly-1, Ly-A, Ly-12
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4305001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 10718143-10738974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10726386 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000025571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025571]
AlphaFold P13379
Predicted Effect possibly damaging
Transcript: ENSMUST00000025571
AA Change: V104A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025571
Gene: ENSMUSG00000024669
AA Change: V104A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SR 34 133 7.43e-19 SMART
low complexity region 138 157 N/A INTRINSIC
SR 276 367 7.27e-4 SMART
transmembrane domain 379 401 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. This protein is a type-I transmembrane glycoprotein found on the surface of thymocytes, T lymphocytes and a subset of B lymphocytes. The encoded protein contains three SRCR domains and may act as a receptor to regulate T-cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Cd5 APN 19 10726295 critical splice donor site probably null
IGL03392:Cd5 APN 19 10726289 splice site probably benign
R0732:Cd5 UTSW 19 10723285 missense probably damaging 1.00
R1831:Cd5 UTSW 19 10719569 missense probably damaging 1.00
R2086:Cd5 UTSW 19 10723256 missense probably benign 0.00
R4184:Cd5 UTSW 19 10721274 missense probably damaging 1.00
R6162:Cd5 UTSW 19 10725880 missense probably damaging 1.00
R6894:Cd5 UTSW 19 10738839 missense possibly damaging 0.91
R7138:Cd5 UTSW 19 10720304 missense probably damaging 1.00
R7653:Cd5 UTSW 19 10726546 missense probably benign 0.00
R8297:Cd5 UTSW 19 10720245 missense probably damaging 1.00
R8408:Cd5 UTSW 19 10723105 missense possibly damaging 0.89
R8411:Cd5 UTSW 19 10720221 missense probably damaging 1.00
R8699:Cd5 UTSW 19 10725192 missense possibly damaging 0.67
R9663:Cd5 UTSW 19 10726494 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGTCAGGGCTCTGTAACTG -3'
(R):5'- GCTCAGATATCCAGGTGATGC -3'

Sequencing Primer
(F):5'- CAGGGCTCTGTAACTGTGAAGC -3'
(R):5'- AGTGGCTCCAATTCCAAGTG -3'
Posted On 2019-06-07