Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Aox2'

554591

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

PIT4362001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58282680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 44 (T44S)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably damaging
Transcript: ENSMUST00000114366
AA Change: T44S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: T44S

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Chuk	A	G	19: 44,098,583		probably null	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grin2c	T	C	11: 115,249,633	T1220A	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pde6b	T	C	5: 108,423,585		probably null	Het
Pdzrn4	A	T	15: 92,769,881	D638V	possibly damaging	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Vil1	G	A	1: 74,421,383	R233H	probably damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TCTTCTCTGCAAATAGAAACAAGCC -3'
(R):5'- CACAGCATTGGTGGGGATTC -3'

Sequencing Primer
(F):5'- TCTGCAAATAGAAACAAGCCAGAATG -3'
(R):5'- GGGATTCCTTCAGTGGGAC -3'

Posted On

2019-06-07