Incidental Mutation 'PIT4362001:Map2'
ID 554592
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Name microtubule-associated protein 2
Synonyms G1-397-34, MAP-2, Mtap2, repro4
Accession Numbers
Essential gene? Possibly essential (E-score: 0.679) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 66214432-66481742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66451677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 189 (G189D)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
AlphaFold P20357
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
AA Change: G189D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: G189D

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222
AA Change: G124D

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
AA Change: G31D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222
AA Change: G31D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
AA Change: G271D

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222
AA Change: G271D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66,464,490 (GRCm39) missense probably damaging 1.00
IGL02135:Map2 APN 1 66,419,920 (GRCm39) nonsense probably null
IGL02526:Map2 APN 1 66,419,876 (GRCm39) missense possibly damaging 0.94
Annas UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
calliope UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
carthage UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
costas UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
Jacobin UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
Nectar UTSW 1 66,454,522 (GRCm39) nonsense probably null
ruby_throat UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
Rufous UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
Speckled UTSW 1 66,451,886 (GRCm39) nonsense probably null
Sunbird UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
swift UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
E0370:Map2 UTSW 1 66,455,883 (GRCm39) unclassified probably benign
R0067:Map2 UTSW 1 66,452,322 (GRCm39) missense probably benign 0.04
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0268:Map2 UTSW 1 66,419,881 (GRCm39) nonsense probably null
R0302:Map2 UTSW 1 66,453,987 (GRCm39) missense probably benign 0.15
R0305:Map2 UTSW 1 66,452,253 (GRCm39) missense probably benign 0.00
R0409:Map2 UTSW 1 66,472,739 (GRCm39) missense probably damaging 1.00
R0561:Map2 UTSW 1 66,464,656 (GRCm39) missense probably damaging 1.00
R0674:Map2 UTSW 1 66,452,361 (GRCm39) missense probably damaging 1.00
R0738:Map2 UTSW 1 66,464,348 (GRCm39) splice site probably benign
R0893:Map2 UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
R1305:Map2 UTSW 1 66,464,554 (GRCm39) missense probably damaging 1.00
R1534:Map2 UTSW 1 66,452,339 (GRCm39) missense probably benign 0.33
R1632:Map2 UTSW 1 66,454,245 (GRCm39) missense possibly damaging 0.60
R1682:Map2 UTSW 1 66,454,781 (GRCm39) splice site probably null
R1774:Map2 UTSW 1 66,453,233 (GRCm39) missense probably damaging 1.00
R2014:Map2 UTSW 1 66,455,295 (GRCm39) missense possibly damaging 0.55
R2017:Map2 UTSW 1 66,451,958 (GRCm39) missense probably damaging 1.00
R2050:Map2 UTSW 1 66,453,473 (GRCm39) missense probably damaging 0.98
R2093:Map2 UTSW 1 66,438,599 (GRCm39) missense probably damaging 1.00
R2214:Map2 UTSW 1 66,459,345 (GRCm39) missense probably damaging 0.99
R2284:Map2 UTSW 1 66,453,227 (GRCm39) missense probably damaging 1.00
R3011:Map2 UTSW 1 66,453,771 (GRCm39) missense probably damaging 1.00
R3105:Map2 UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
R3708:Map2 UTSW 1 66,455,714 (GRCm39) unclassified probably benign
R3709:Map2 UTSW 1 66,455,015 (GRCm39) nonsense probably null
R3729:Map2 UTSW 1 66,451,605 (GRCm39) missense possibly damaging 0.80
R3760:Map2 UTSW 1 66,478,077 (GRCm39) missense probably damaging 1.00
R3788:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R3789:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R4003:Map2 UTSW 1 66,454,899 (GRCm39) missense probably damaging 1.00
R4120:Map2 UTSW 1 66,455,063 (GRCm39) missense probably damaging 1.00
R4172:Map2 UTSW 1 66,452,759 (GRCm39) missense possibly damaging 0.89
R4198:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4200:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4205:Map2 UTSW 1 66,464,449 (GRCm39) missense probably damaging 1.00
R4613:Map2 UTSW 1 66,464,628 (GRCm39) missense probably damaging 1.00
R4700:Map2 UTSW 1 66,449,796 (GRCm39) missense probably damaging 0.96
R4974:Map2 UTSW 1 66,452,664 (GRCm39) missense probably benign 0.15
R5007:Map2 UTSW 1 66,452,448 (GRCm39) missense possibly damaging 0.86
R5039:Map2 UTSW 1 66,477,955 (GRCm39) missense probably damaging 1.00
R5237:Map2 UTSW 1 66,478,169 (GRCm39) unclassified probably benign
R5313:Map2 UTSW 1 66,464,538 (GRCm39) missense probably damaging 1.00
R5455:Map2 UTSW 1 66,438,550 (GRCm39) missense probably damaging 1.00
R5490:Map2 UTSW 1 66,452,292 (GRCm39) missense probably damaging 1.00
R5517:Map2 UTSW 1 66,454,415 (GRCm39) missense probably benign 0.00
R5532:Map2 UTSW 1 66,453,779 (GRCm39) missense probably damaging 1.00
R5583:Map2 UTSW 1 66,455,196 (GRCm39) missense probably damaging 1.00
R5764:Map2 UTSW 1 66,454,034 (GRCm39) missense probably damaging 0.99
R5996:Map2 UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
R6058:Map2 UTSW 1 66,454,573 (GRCm39) missense probably benign 0.05
R6199:Map2 UTSW 1 66,464,637 (GRCm39) missense probably damaging 1.00
R6208:Map2 UTSW 1 66,470,749 (GRCm39) missense probably damaging 1.00
R6276:Map2 UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
R6378:Map2 UTSW 1 66,454,488 (GRCm39) missense probably damaging 1.00
R6424:Map2 UTSW 1 66,453,946 (GRCm39) missense possibly damaging 0.67
R6743:Map2 UTSW 1 66,454,766 (GRCm39) missense probably benign 0.04
R6837:Map2 UTSW 1 66,453,731 (GRCm39) missense probably damaging 1.00
R6901:Map2 UTSW 1 66,460,932 (GRCm39) missense possibly damaging 0.94
R6984:Map2 UTSW 1 66,454,395 (GRCm39) missense possibly damaging 0.90
R6989:Map2 UTSW 1 66,454,065 (GRCm39) missense probably benign 0.00
R7001:Map2 UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
R7055:Map2 UTSW 1 66,455,983 (GRCm39) missense probably damaging 1.00
R7094:Map2 UTSW 1 66,451,886 (GRCm39) nonsense probably null
R7106:Map2 UTSW 1 66,449,903 (GRCm39) missense possibly damaging 0.92
R7182:Map2 UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
R7235:Map2 UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
R7424:Map2 UTSW 1 66,453,983 (GRCm39) missense possibly damaging 0.69
R7473:Map2 UTSW 1 66,454,617 (GRCm39) missense probably damaging 1.00
R7642:Map2 UTSW 1 66,452,466 (GRCm39) missense probably benign 0.01
R7660:Map2 UTSW 1 66,453,536 (GRCm39) missense probably damaging 1.00
R7673:Map2 UTSW 1 66,452,933 (GRCm39) missense probably benign 0.03
R7768:Map2 UTSW 1 66,453,642 (GRCm39) missense possibly damaging 0.94
R7796:Map2 UTSW 1 66,455,654 (GRCm39) splice site probably null
R7834:Map2 UTSW 1 66,455,647 (GRCm39) missense probably damaging 1.00
R7842:Map2 UTSW 1 66,455,570 (GRCm39) missense probably benign
R7955:Map2 UTSW 1 66,452,875 (GRCm39) missense probably damaging 1.00
R8056:Map2 UTSW 1 66,454,779 (GRCm39) missense probably damaging 0.99
R8118:Map2 UTSW 1 66,464,550 (GRCm39) missense probably damaging 1.00
R8135:Map2 UTSW 1 66,452,828 (GRCm39) missense probably damaging 1.00
R8152:Map2 UTSW 1 66,453,902 (GRCm39) missense probably benign 0.00
R8223:Map2 UTSW 1 66,464,649 (GRCm39) missense probably damaging 1.00
R8329:Map2 UTSW 1 66,454,272 (GRCm39) missense probably benign 0.01
R8344:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8475:Map2 UTSW 1 66,453,164 (GRCm39) missense probably damaging 1.00
R8548:Map2 UTSW 1 66,452,499 (GRCm39) missense probably damaging 1.00
R8680:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8713:Map2 UTSW 1 66,453,781 (GRCm39) missense probably damaging 1.00
R8745:Map2 UTSW 1 66,452,556 (GRCm39) missense probably benign 0.00
R8786:Map2 UTSW 1 66,472,755 (GRCm39) critical splice donor site probably benign
R8790:Map2 UTSW 1 66,477,997 (GRCm39) missense probably damaging 1.00
R8874:Map2 UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
R8887:Map2 UTSW 1 66,454,758 (GRCm39) missense possibly damaging 0.48
R8948:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8950:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8998:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R8999:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R9072:Map2 UTSW 1 66,453,312 (GRCm39) missense probably damaging 1.00
R9088:Map2 UTSW 1 66,453,773 (GRCm39) missense probably damaging 1.00
R9089:Map2 UTSW 1 66,452,098 (GRCm39) missense probably benign 0.09
R9106:Map2 UTSW 1 66,454,522 (GRCm39) nonsense probably null
R9112:Map2 UTSW 1 66,472,723 (GRCm39) nonsense probably null
R9120:Map2 UTSW 1 66,453,218 (GRCm39) missense probably damaging 1.00
R9161:Map2 UTSW 1 66,477,503 (GRCm39) missense possibly damaging 0.65
R9464:Map2 UTSW 1 66,454,497 (GRCm39) missense probably damaging 1.00
R9589:Map2 UTSW 1 66,449,753 (GRCm39) missense probably benign
V8831:Map2 UTSW 1 66,455,004 (GRCm39) missense probably damaging 1.00
Z1177:Map2 UTSW 1 66,477,520 (GRCm39) missense probably damaging 0.96
Z1177:Map2 UTSW 1 66,419,839 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGTGCCTGAAAGCTGTTGC -3'
(R):5'- CAATGAACCAGTCTTTTGGCTC -3'

Sequencing Primer
(F):5'- GCCTGAAAGCTGTTGCCTATTATCTG -3'
(R):5'- AATGAACCAGTCTTTTGGCTCTTTTG -3'
Posted On 2019-06-07