Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Vil1'

554594

Institutional Source

Beutler Lab

Gene Symbol

Vil1

Ensembl Gene

ENSMUSG00000026175

Gene Name

villin 1

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

PIT4362001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74409376-74435559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74421383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 233 (R233H)

Ref Sequence

ENSEMBL: ENSMUSP00000027366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027366]

AlphaFold

Q62468

Predicted Effect

probably damaging
Transcript: ENSMUST00000027366
AA Change: R233H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: R233H

Domain	Start	End	E-Value	Type
GEL	17	114	2.93e-29	SMART
GEL	135	229	1.33e-18	SMART
GEL	251	349	5.85e-29	SMART
GEL	398	495	1.44e-28	SMART
GEL	515	601	7.31e-30	SMART
GEL	620	714	1.36e-29	SMART
VHP	792	827	1.77e-14	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175
AA Change: R134H

Domain	Start	End	E-Value	Type
GEL	37	131	1.33e-18	SMART
GEL	153	248	6.68e-24	SMART

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

MGI Phenotype

Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Aox2	A	T	1: 58,282,680	T44S	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Chuk	A	G	19: 44,098,583		probably null	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grin2c	T	C	11: 115,249,633	T1220A	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pde6b	T	C	5: 108,423,585		probably null	Het
Pdzrn4	A	T	15: 92,769,881	D638V	possibly damaging	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Vil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Vil1	APN	1	74423875	missense	probably damaging	1.00
IGL00703:Vil1	APN	1	74423960	missense	possibly damaging	0.61
IGL01011:Vil1	APN	1	74434887	splice site	probably null
IGL01314:Vil1	APN	1	74428238	missense	probably damaging	1.00
IGL01772:Vil1	APN	1	74415119	missense	probably benign
IGL02378:Vil1	APN	1	74430691	splice site	probably null
IGL02517:Vil1	APN	1	74426692	missense	probably benign	0.43
IGL02955:Vil1	APN	1	74418523	missense	probably benign	0.10
IGL03036:Vil1	APN	1	74419612	missense	probably damaging	1.00
R0104:Vil1	UTSW	1	74418366	missense	probably benign	0.44
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0496:Vil1	UTSW	1	74421340	missense	possibly damaging	0.88
R1329:Vil1	UTSW	1	74427558	missense	probably benign	0.00
R1824:Vil1	UTSW	1	74418447	missense	probably benign	0.00
R1916:Vil1	UTSW	1	74418525	missense	probably benign
R2188:Vil1	UTSW	1	74427565	missense	probably benign	0.22
R2216:Vil1	UTSW	1	74425679	missense	probably benign	0.05
R3808:Vil1	UTSW	1	74427613	missense	probably benign
R3939:Vil1	UTSW	1	74432415	missense	probably benign	0.09
R4288:Vil1	UTSW	1	74418525	missense	probably benign
R4648:Vil1	UTSW	1	74432298	missense	probably benign
R4748:Vil1	UTSW	1	74421266	missense	probably damaging	1.00
R5333:Vil1	UTSW	1	74432390	missense	probably benign
R5429:Vil1	UTSW	1	74432331	missense	probably benign	0.05
R5973:Vil1	UTSW	1	74416033	missense	possibly damaging	0.93
R6007:Vil1	UTSW	1	74419867	missense	probably damaging	1.00
R6247:Vil1	UTSW	1	74432339	missense	probably benign
R6306:Vil1	UTSW	1	74421311	missense	possibly damaging	0.90
R6989:Vil1	UTSW	1	74423954	missense	probably damaging	0.99
R7112:Vil1	UTSW	1	74416002	missense	probably damaging	1.00
R7320:Vil1	UTSW	1	74418444	missense	probably damaging	1.00
R7481:Vil1	UTSW	1	74419899	missense	probably damaging	1.00
R7553:Vil1	UTSW	1	74426732	critical splice donor site	probably null
R7709:Vil1	UTSW	1	74426595	missense	probably benign	0.39
R7791:Vil1	UTSW	1	74428136	missense	probably damaging	1.00
R8159:Vil1	UTSW	1	74423977	missense	probably benign	0.00
R8190:Vil1	UTSW	1	74434893	nonsense	probably null
R9650:Vil1	UTSW	1	74425616	missense	probably benign	0.32
R9679:Vil1	UTSW	1	74430674	missense	probably benign	0.00
R9734:Vil1	UTSW	1	74415150	missense	possibly damaging	0.46
Z1176:Vil1	UTSW	1	74428232	missense	probably damaging	0.98
Z1177:Vil1	UTSW	1	74415132	missense	probably damaging	1.00
Z1177:Vil1	UTSW	1	74421430	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGCAAAGTTCAGGGTGGTG -3'
(R):5'- TCCTTCGGAGTCAGACACACTG -3'

Sequencing Primer
(F):5'- TGGTGAACACTGCTACCCTG -3'
(R):5'- GGAGTCAGACACACTGCAGAAC -3'

Posted On

2019-06-07