Incidental Mutation 'PIT4362001:Vil1'
List |< first << previous [record 67 of 72] next >> last >|
ID554594
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Namevillin 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74409376-74435559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74421383 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 233 (R233H)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366]
Predicted Effect probably damaging
Transcript: ENSMUST00000027366
AA Change: R233H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: R233H

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175
AA Change: R134H

DomainStartEndE-ValueType
GEL 37 131 1.33e-18 SMART
GEL 153 248 6.68e-24 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 splice site probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74427558 missense probably benign 0.00
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R3939:Vil1 UTSW 1 74432415 missense probably benign 0.09
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4648:Vil1 UTSW 1 74432298 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7320:Vil1 UTSW 1 74418444 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R7791:Vil1 UTSW 1 74428136 missense probably damaging 1.00
R8159:Vil1 UTSW 1 74423977 missense probably benign 0.00
R8190:Vil1 UTSW 1 74434893 nonsense probably null
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAAAGTTCAGGGTGGTG -3'
(R):5'- TCCTTCGGAGTCAGACACACTG -3'

Sequencing Primer
(F):5'- TGGTGAACACTGCTACCCTG -3'
(R):5'- GGAGTCAGACACACTGCAGAAC -3'
Posted On2019-06-07