Incidental Mutation 'PIT4362001:Dcaf8'
ID554595
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene NameDDB1 and CUL4 associated factor 8
SynonymsD1Dau35e, Wdr42a, D1Ucla4, H326
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172148084-172197005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172172797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 174 (V174A)
Ref Sequence ENSEMBL: ENSMUSP00000073778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074144] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
Predicted Effect probably damaging
Transcript: ENSMUST00000074144
AA Change: V174A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: V174A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191689
AA Change: V174A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: V174A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192704
AA Change: V174A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: V174A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193638
AA Change: V174A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554
AA Change: V174A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195345
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172172908 missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172172856 missense probably damaging 1.00
R0329:Dcaf8 UTSW 1 172187411 missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172174043 missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172172654 missense probably benign
R0731:Dcaf8 UTSW 1 172172509 missense possibly damaging 0.66
R1389:Dcaf8 UTSW 1 172174052 missense probably benign 0.00
R1496:Dcaf8 UTSW 1 172193855 missense probably benign 0.39
R1719:Dcaf8 UTSW 1 172175495 missense probably damaging 0.96
R1856:Dcaf8 UTSW 1 172175553 missense probably damaging 1.00
R2342:Dcaf8 UTSW 1 172186361 missense possibly damaging 0.48
R2512:Dcaf8 UTSW 1 172189035 missense possibly damaging 0.95
R4163:Dcaf8 UTSW 1 172192570 missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172179893 splice site probably benign
R4880:Dcaf8 UTSW 1 172187489 intron probably benign
R5092:Dcaf8 UTSW 1 172186909 missense probably benign 0.02
R5622:Dcaf8 UTSW 1 172186398 intron probably benign
R5734:Dcaf8 UTSW 1 172172911 missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 172165867 start codon destroyed probably benign 0.01
R7090:Dcaf8 UTSW 1 172188968 missense probably damaging 0.96
R8178:Dcaf8 UTSW 1 172186319 missense probably benign 0.22
Z1176:Dcaf8 UTSW 1 172172929 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCATGGCCACTCAGACGAAG -3'
(R):5'- TTTGTGGCCACTCTCAAAGTC -3'

Sequencing Primer
(F):5'- GAACAACCTCGGCACCGTG -3'
(R):5'- GGCCACTCTCAAAGTCCAGTACTG -3'
Posted On2019-06-07