Incidental Mutation 'PIT4362001:Egfl7'
ID 554596
Institutional Source Beutler Lab
Gene Symbol Egfl7
Ensembl Gene ENSMUSG00000026921
Gene Name EGF-like domain 7
Synonyms vascular endothelial-statin, VE-statin, Zneu1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26471095-26482694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26481052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 188 (P188L)
Ref Sequence ENSEMBL: ENSMUSP00000099971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000100290] [ENSMUST00000102907] [ENSMUST00000139801] [ENSMUST00000145575] [ENSMUST00000149789] [ENSMUST00000150404] [ENSMUST00000152713] [ENSMUST00000152988] [ENSMUST00000166920] [ENSMUST00000173920] [ENSMUST00000174066] [ENSMUST00000174211]
AlphaFold Q9QXT5
Predicted Effect probably benign
Transcript: ENSMUST00000028286
SMART Domains Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
PlsC 92 207 5.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100290
AA Change: P188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097863
Gene: ENSMUSG00000026921
AA Change: P188L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.5e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102907
AA Change: P188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099971
Gene: ENSMUSG00000026921
AA Change: P188L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 32 98 5.6e-21 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000139801
AA Change: R215W
SMART Domains Protein: ENSMUSP00000123465
Gene: ENSMUSG00000026921
AA Change: R215W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 6.9e-20 PFAM
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145575
SMART Domains Protein: ENSMUSP00000118924
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 8e-20 PFAM
EGF 110 139 2.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149789
Predicted Effect probably benign
Transcript: ENSMUST00000150404
AA Change: P188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115482
Gene: ENSMUSG00000026921
AA Change: P188L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152713
Predicted Effect probably benign
Transcript: ENSMUST00000152988
Predicted Effect probably benign
Transcript: ENSMUST00000166920
AA Change: P188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128741
Gene: ENSMUSG00000026921
AA Change: P188L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173920
SMART Domains Protein: ENSMUSP00000134503
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174211
AA Change: P188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134034
Gene: ENSMUSG00000026921
AA Change: P188L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality with absent heartbeat and systemic edema, delayed vasculogenesis, decreased angiogenesis, abnormal adult vasculature, and low-level hypoxia. Mice homozygous for a null allele that does not disrupt Mirn126 expression are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Egfl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03279:Egfl7 APN 2 26,480,719 (GRCm39) missense probably benign 0.08
R0607:Egfl7 UTSW 2 26,479,452 (GRCm39) missense probably damaging 1.00
R0678:Egfl7 UTSW 2 26,480,952 (GRCm39) missense probably benign 0.02
R2404:Egfl7 UTSW 2 26,479,162 (GRCm39) missense possibly damaging 0.88
R4921:Egfl7 UTSW 2 26,480,992 (GRCm39) missense probably benign 0.05
R5572:Egfl7 UTSW 2 26,481,703 (GRCm39) missense possibly damaging 0.92
R7332:Egfl7 UTSW 2 26,480,725 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGCCTCCTGTAGACACTAGATTG -3'
(R):5'- AATGCCTTCCAGAAACCTCTTC -3'

Sequencing Primer
(F):5'- CTGTAGACACTAGATTGACACCTTC -3'
(R):5'- AACCTCTTCAGGGTAAAGTGGCC -3'
Posted On 2019-06-07