Incidental Mutation 'PIT4362001:Olfr1002'
ID 554600
Institutional Source Beutler Lab
Gene Symbol Olfr1002
Ensembl Gene ENSMUSG00000075214
Gene Name olfactory receptor 1002
Synonyms GA_x6K02T2Q125-47127746-47126790, MOR175-2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85646057-85650704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 85647724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 199 (L199R)
Ref Sequence ENSEMBL: ENSMUSP00000150405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099920] [ENSMUST00000215548]
AlphaFold Q8VFK2
Predicted Effect probably damaging
Transcript: ENSMUST00000099920
AA Change: L199R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097504
Gene: ENSMUSG00000075214
AA Change: L199R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-50 PFAM
Pfam:7tm_1 41 290 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215548
AA Change: L199R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Olfr1002
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Olfr1002 APN 2 85648143 missense probably damaging 0.98
IGL02873:Olfr1002 APN 2 85647752 missense possibly damaging 0.50
R1241:Olfr1002 UTSW 2 85647560 missense probably damaging 1.00
R1261:Olfr1002 UTSW 2 85647799 missense probably damaging 1.00
R1666:Olfr1002 UTSW 2 85647813 nonsense probably null
R1902:Olfr1002 UTSW 2 85647857 missense possibly damaging 0.81
R1965:Olfr1002 UTSW 2 85647746 missense possibly damaging 0.94
R2096:Olfr1002 UTSW 2 85648090 missense probably benign 0.20
R4239:Olfr1002 UTSW 2 85648303 missense probably damaging 0.98
R4730:Olfr1002 UTSW 2 85647992 missense probably benign 0.39
R4948:Olfr1002 UTSW 2 85647572 missense probably benign 0.30
R5627:Olfr1002 UTSW 2 85647647 missense probably damaging 1.00
R5844:Olfr1002 UTSW 2 85647895 missense probably benign 0.36
R6809:Olfr1002 UTSW 2 85647973 missense probably damaging 1.00
R7399:Olfr1002 UTSW 2 85647424 missense possibly damaging 0.89
R7476:Olfr1002 UTSW 2 85648168 missense not run
R7805:Olfr1002 UTSW 2 85647450 nonsense probably null
R7960:Olfr1002 UTSW 2 85648073 missense possibly damaging 0.82
R8015:Olfr1002 UTSW 2 85647792 missense probably damaging 0.99
R8355:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8455:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8479:Olfr1002 UTSW 2 85648103 missense probably damaging 1.00
R8683:Olfr1002 UTSW 2 85648066 missense probably benign 0.35
R8699:Olfr1002 UTSW 2 85647986 missense possibly damaging 0.87
R8762:Olfr1002 UTSW 2 85647690 missense probably damaging 1.00
R8897:Olfr1002 UTSW 2 85647843 missense possibly damaging 0.92
R9280:Olfr1002 UTSW 2 85648160 nonsense probably null
R9674:Olfr1002 UTSW 2 85648249 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGGAGCTTGGACGTACATAG -3'
(R):5'- ATACTCTCATCATGTCCCAGCG -3'

Sequencing Primer
(F):5'- TGGAGCTTGGACGTACATAGATAAAG -3'
(R):5'- CCCAGCGAGTCTGTGTACAGTTAG -3'
Posted On 2019-06-07