Incidental Mutation 'PIT4362001:Arhgap29'
ID 554608
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene Name Rho GTPase activating protein 29
Synonyms C76601, Parg1, B130017I01Rik, 6720461J18Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121746752-121810326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121796861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 482 (N482K)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]
AlphaFold Q8CGF1
Predicted Effect probably benign
Transcript: ENSMUST00000037958
AA Change: N482K

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: N482K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197155
AA Change: N482K

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: N482K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198914
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 121,796,961 (GRCm39) nonsense probably null
IGL01121:Arhgap29 APN 3 121,803,512 (GRCm39) missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121,767,773 (GRCm39) splice site probably benign
IGL01623:Arhgap29 APN 3 121,767,773 (GRCm39) splice site probably benign
IGL01995:Arhgap29 APN 3 121,807,977 (GRCm39) missense probably benign 0.00
IGL02120:Arhgap29 APN 3 121,797,906 (GRCm39) missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121,786,173 (GRCm39) unclassified probably benign
IGL02931:Arhgap29 APN 3 121,786,509 (GRCm39) missense probably benign
IGL02937:Arhgap29 APN 3 121,767,698 (GRCm39) missense probably damaging 0.99
R0022:Arhgap29 UTSW 3 121,782,586 (GRCm39) missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 121,801,274 (GRCm39) missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121,784,759 (GRCm39) missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 121,801,290 (GRCm39) missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 121,808,328 (GRCm39) missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 121,796,989 (GRCm39) missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121,786,044 (GRCm39) missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121,786,044 (GRCm39) missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121,767,578 (GRCm39) missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121,767,578 (GRCm39) missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121,785,968 (GRCm39) unclassified probably benign
R1710:Arhgap29 UTSW 3 121,801,729 (GRCm39) missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 121,805,020 (GRCm39) missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121,775,509 (GRCm39) missense probably benign 0.01
R2112:Arhgap29 UTSW 3 121,805,210 (GRCm39) missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121,784,658 (GRCm39) missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 121,805,102 (GRCm39) missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121,767,629 (GRCm39) missense probably benign
R3618:Arhgap29 UTSW 3 121,782,176 (GRCm39) missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 121,808,620 (GRCm39) missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 121,803,607 (GRCm39) missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 121,803,709 (GRCm39) critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121,767,653 (GRCm39) missense probably benign 0.00
R5045:Arhgap29 UTSW 3 121,796,244 (GRCm39) missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121,782,200 (GRCm39) missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 121,808,578 (GRCm39) missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121,775,560 (GRCm39) missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 121,807,894 (GRCm39) missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 121,805,736 (GRCm39) missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121,786,397 (GRCm39) missense probably benign 0.00
R6355:Arhgap29 UTSW 3 121,804,907 (GRCm39) missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121,787,230 (GRCm39) missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 121,808,351 (GRCm39) missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121,782,599 (GRCm39) missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121,786,461 (GRCm39) missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 121,807,981 (GRCm39) missense probably benign 0.01
R8045:Arhgap29 UTSW 3 121,801,211 (GRCm39) synonymous silent
R8048:Arhgap29 UTSW 3 121,786,550 (GRCm39) missense probably damaging 1.00
R8165:Arhgap29 UTSW 3 121,782,222 (GRCm39) missense probably damaging 0.98
R9001:Arhgap29 UTSW 3 121,775,523 (GRCm39) missense probably benign 0.03
R9032:Arhgap29 UTSW 3 121,808,249 (GRCm39) missense probably benign
R9060:Arhgap29 UTSW 3 121,783,973 (GRCm39) missense probably damaging 0.99
R9085:Arhgap29 UTSW 3 121,808,249 (GRCm39) missense probably benign
R9717:Arhgap29 UTSW 3 121,797,920 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATGATGCTTTCTATTTTCACACG -3'
(R):5'- CCTGCTGTTTCATAGAGCTGTG -3'

Sequencing Primer
(F):5'- CACACGCTTCTTTGAGTCTTAAAAAC -3'
(R):5'- CTGTTTCATAGAGCTGTGTCTGC -3'
Posted On 2019-06-07