Incidental Mutation 'PIT4362001:Atp6v0b'
ID554615
Institutional Source Beutler Lab
Gene Symbol Atp6v0b
Ensembl Gene ENSMUSG00000033379
Gene NameATPase, H+ transporting, lysosomal V0 subunit B
Synonyms2310024H13Rik, VMA16, Atp6f
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #PIT4362001 (G1)
Quality Score119.008
Status Not validated
Chromosome4
Chromosomal Location117884326-117887333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117885256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 147 (S147P)
Ref Sequence ENSEMBL: ENSMUSP00000047682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030265] [ENSMUST00000030266] [ENSMUST00000036380] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000132073] [ENSMUST00000136596] [ENSMUST00000147845] [ENSMUST00000149868] [ENSMUST00000150204] [ENSMUST00000153358] [ENSMUST00000167443] [ENSMUST00000171548] [ENSMUST00000183773]
Predicted Effect probably benign
Transcript: ENSMUST00000030265
SMART Domains Protein: ENSMUSP00000030265
Gene: ENSMUSG00000028540

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 54 375 2.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036380
AA Change: S147P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047682
Gene: ENSMUSG00000033379
AA Change: S147P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ATP-synt_C 50 112 1.2e-15 PFAM
Pfam:ATP-synt_C 136 198 1.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132073
SMART Domains Protein: ENSMUSP00000137654
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136596
Predicted Effect probably benign
Transcript: ENSMUST00000147845
Predicted Effect possibly damaging
Transcript: ENSMUST00000149868
AA Change: S100P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137788
Gene: ENSMUSG00000033379
AA Change: S100P

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 3.1e-19 PFAM
transmembrane domain 84 106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150204
AA Change: S100P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119988
Gene: ENSMUSG00000033379
AA Change: S100P

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 8.2e-19 PFAM
Pfam:ATP-synt_C 88 152 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153358
SMART Domains Protein: ENSMUSP00000120571
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 197 9.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171548
SMART Domains Protein: ENSMUSP00000126539
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183773
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Atp6v0b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Atp6v0b APN 4 117885106 nonsense probably null
IGL01556:Atp6v0b APN 4 117885865 missense probably damaging 1.00
IGL01998:Atp6v0b APN 4 117886066 critical splice donor site probably null
IGL02369:Atp6v0b APN 4 117885653 missense possibly damaging 0.95
IGL02953:Atp6v0b APN 4 117885222 missense probably damaging 1.00
R0244:Atp6v0b UTSW 4 117884622 missense probably damaging 1.00
R5636:Atp6v0b UTSW 4 117886385 unclassified probably benign
R6974:Atp6v0b UTSW 4 117885667 missense probably benign 0.19
R7581:Atp6v0b UTSW 4 117885286 missense probably benign 0.00
R7851:Atp6v0b UTSW 4 117885865 missense probably damaging 1.00
R7866:Atp6v0b UTSW 4 117885153 missense probably damaging 1.00
X0057:Atp6v0b UTSW 4 117886623 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAAGGGAGGCACTTCTGTTC -3'
(R):5'- ACACTTGCTTCTACCACACG -3'

Sequencing Primer
(F):5'- TTCCTCTCTAGGGGGACTCG -3'
(R):5'- GTACACACCTGGGCCTTAC -3'
Posted On2019-06-07