Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Pde6b'

554619

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

Accession Numbers

Genbank: NM_008806; MGI: 97525

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4362001 (G1)

Quality Score

150.008

Status

Not validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 108423585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

AlphaFold

P23440

Predicted Effect

probably null
Transcript: ENSMUST00000031456

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Aox2	A	T	1: 58,282,680	T44S	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Chuk	A	G	19: 44,098,583		probably null	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grin2c	T	C	11: 115,249,633	T1220A	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pdzrn4	A	T	15: 92,769,881	D638V	possibly damaging	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Vil1	G	A	1: 74,421,383	R233H	probably damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1801:Pde6b	UTSW	5	108427847	missense	possibly damaging	0.51
R1913:Pde6b	UTSW	5	108427190	missense	probably benign	0.05
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4972:Pde6b	UTSW	5	108425264	missense	probably benign	0.00
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5528:Pde6b	UTSW	5	108423558	missense	probably benign	0.04
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R7937:Pde6b	UTSW	5	108419773	critical splice donor site	probably null
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00
R8698:Pde6b	UTSW	5	108428239	missense	possibly damaging	0.87
R8822:Pde6b	UTSW	5	108403462	missense	probably benign	0.00
R8985:Pde6b	UTSW	5	108430637	missense	probably benign	0.02
R9016:Pde6b	UTSW	5	108388726	missense	possibly damaging	0.88
R9292:Pde6b	UTSW	5	108388885	missense	probably benign	0.00
R9323:Pde6b	UTSW	5	108403432	missense	probably damaging	1.00
R9414:Pde6b	UTSW	5	108419726	missense	possibly damaging	0.82
R9486:Pde6b	UTSW	5	108403375	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAAACTGGCCTCTGAGACAC -3'
(R):5'- TCTAGGAAGGTTCTGTTCACAC -3'

Sequencing Primer
(F):5'- CTCACCAAAGTGCATGGCTAATGG -3'
(R):5'- ACCTACTCACTGCTTAGGATGAGG -3'

Posted On

2019-06-07