Incidental Mutation 'PIT4362001:Ube3a'
ID 554623
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Name ubiquitin protein ligase E3A
Synonyms A130086L21Rik, E6-AP ubiquitin protein ligase, 5830462N02Rik, Hpve6a
Accession Numbers
Essential gene? Possibly essential (E-score: 0.713) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 58878498-58961284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58925870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 237 (V237A)
Ref Sequence ENSEMBL: ENSMUSP00000143859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200709] [ENSMUST00000200758] [ENSMUST00000201409] [ENSMUST00000202440] [ENSMUST00000202945] [ENSMUST00000207686] [ENSMUST00000208313]
AlphaFold O08759
Predicted Effect possibly damaging
Transcript: ENSMUST00000107537
AA Change: V216A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: V216A

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200709
Predicted Effect possibly damaging
Transcript: ENSMUST00000200758
AA Change: V237A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: V237A

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201409
AA Change: V237A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144220
Gene: ENSMUSG00000025326
AA Change: V237A

DomainStartEndE-ValueType
Pfam:AZUL 27 81 3.4e-18 PFAM
Blast:HECTc 108 169 5e-22 BLAST
low complexity region 170 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202440
SMART Domains Protein: ENSMUSP00000143896
Gene: ENSMUSG00000025326

DomainStartEndE-ValueType
Pfam:AZUL 6 50 1.4e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202945
AA Change: V216A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: V216A

DomainStartEndE-ValueType
Pfam:AZUL 6 60 4.4e-21 PFAM
Blast:HECTc 87 148 2e-20 BLAST
low complexity region 149 186 N/A INTRINSIC
Blast:HECTc 338 459 1e-12 BLAST
HECTc 519 762 7.07e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207686
Predicted Effect probably benign
Transcript: ENSMUST00000208313
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 58,921,858 (GRCm39) missense probably damaging 1.00
IGL00886:Ube3a APN 7 58,934,485 (GRCm39) missense probably damaging 1.00
IGL02037:Ube3a APN 7 58,925,506 (GRCm39) unclassified probably benign
IGL02127:Ube3a APN 7 58,925,789 (GRCm39) missense probably benign 0.03
IGL02228:Ube3a APN 7 58,938,144 (GRCm39) splice site probably benign
IGL02533:Ube3a APN 7 58,954,580 (GRCm39) missense probably damaging 1.00
IGL02706:Ube3a APN 7 58,921,881 (GRCm39) missense possibly damaging 0.67
IGL03037:Ube3a APN 7 58,896,971 (GRCm39) splice site probably benign
IGL03213:Ube3a APN 7 58,935,870 (GRCm39) nonsense probably null
IGL03306:Ube3a APN 7 58,935,895 (GRCm39) missense probably damaging 1.00
Kebab UTSW 7 58,938,236 (GRCm39) missense probably damaging 1.00
Shawarma UTSW 7 58,925,931 (GRCm39) nonsense probably null
R0847:Ube3a UTSW 7 58,926,334 (GRCm39) missense possibly damaging 0.80
R1765:Ube3a UTSW 7 58,935,862 (GRCm39) missense probably damaging 1.00
R1771:Ube3a UTSW 7 58,925,714 (GRCm39) missense probably damaging 1.00
R1926:Ube3a UTSW 7 58,926,127 (GRCm39) missense probably damaging 1.00
R1992:Ube3a UTSW 7 58,953,535 (GRCm39) missense probably damaging 1.00
R2026:Ube3a UTSW 7 58,953,474 (GRCm39) missense probably damaging 1.00
R2104:Ube3a UTSW 7 58,926,225 (GRCm39) missense possibly damaging 0.95
R3176:Ube3a UTSW 7 58,926,267 (GRCm39) nonsense probably null
R3276:Ube3a UTSW 7 58,926,267 (GRCm39) nonsense probably null
R3623:Ube3a UTSW 7 58,921,860 (GRCm39) missense probably damaging 1.00
R3624:Ube3a UTSW 7 58,921,860 (GRCm39) missense probably damaging 1.00
R3690:Ube3a UTSW 7 58,926,547 (GRCm39) missense probably damaging 1.00
R4423:Ube3a UTSW 7 58,925,861 (GRCm39) missense probably benign 0.10
R4583:Ube3a UTSW 7 58,935,811 (GRCm39) missense probably damaging 1.00
R4883:Ube3a UTSW 7 58,893,198 (GRCm39) start codon destroyed probably benign 0.21
R4992:Ube3a UTSW 7 58,934,568 (GRCm39) missense possibly damaging 0.47
R5175:Ube3a UTSW 7 58,938,465 (GRCm39) missense probably damaging 1.00
R5397:Ube3a UTSW 7 58,936,660 (GRCm39) missense probably benign 0.26
R5545:Ube3a UTSW 7 58,921,772 (GRCm39) missense probably damaging 1.00
R5572:Ube3a UTSW 7 58,938,525 (GRCm39) missense probably damaging 1.00
R5635:Ube3a UTSW 7 58,938,236 (GRCm39) missense probably damaging 1.00
R5766:Ube3a UTSW 7 58,925,807 (GRCm39) missense possibly damaging 0.89
R5890:Ube3a UTSW 7 58,921,776 (GRCm39) missense probably damaging 1.00
R5956:Ube3a UTSW 7 58,926,768 (GRCm39) unclassified probably benign
R6388:Ube3a UTSW 7 58,954,669 (GRCm39) splice site probably null
R6464:Ube3a UTSW 7 58,925,931 (GRCm39) nonsense probably null
R6467:Ube3a UTSW 7 58,926,650 (GRCm39) missense probably damaging 1.00
R6474:Ube3a UTSW 7 58,936,772 (GRCm39) missense probably damaging 1.00
R6669:Ube3a UTSW 7 58,926,605 (GRCm39) missense probably benign 0.02
R7003:Ube3a UTSW 7 58,926,188 (GRCm39) missense probably damaging 1.00
R7044:Ube3a UTSW 7 58,938,161 (GRCm39) missense probably damaging 1.00
R7187:Ube3a UTSW 7 58,925,653 (GRCm39) missense probably benign 0.02
R7360:Ube3a UTSW 7 58,926,383 (GRCm39) missense probably damaging 1.00
R7363:Ube3a UTSW 7 58,936,751 (GRCm39) missense probably benign 0.00
R7508:Ube3a UTSW 7 58,953,437 (GRCm39) missense possibly damaging 0.84
R7652:Ube3a UTSW 7 58,893,102 (GRCm39) start gained probably benign
R7768:Ube3a UTSW 7 58,938,525 (GRCm39) missense probably damaging 1.00
R8015:Ube3a UTSW 7 58,934,504 (GRCm39) missense probably damaging 1.00
R8044:Ube3a UTSW 7 58,926,320 (GRCm39) missense possibly damaging 0.51
R8476:Ube3a UTSW 7 58,954,575 (GRCm39) missense probably damaging 1.00
R9394:Ube3a UTSW 7 58,921,960 (GRCm39) nonsense probably null
R9404:Ube3a UTSW 7 58,936,763 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTCGGAAAGTCAAACAGC -3'
(R):5'- TCCAGATATTCAGGACTGTGGAG -3'

Sequencing Primer
(F):5'- CACAAAGGAGGAATTGAAATCTCTTC -3'
(R):5'- CAGGACTGTGGAGATTACTATTCTCC -3'
Posted On 2019-06-07