Incidental Mutation 'PIT4362001:Cog4'
ID 554627
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Name component of oligomeric golgi complex 4
Synonyms D8Ertd515e
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111573232-111608859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 111593304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 472 (D472N)
Ref Sequence ENSEMBL: ENSMUSP00000034203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679]
AlphaFold Q8R1U1
Predicted Effect probably damaging
Transcript: ENSMUST00000034203
AA Change: D472N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: D472N

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165867
AA Change: D399N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: D399N

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172542
AA Change: D134N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753
AA Change: D134N

DomainStartEndE-ValueType
Pfam:COG4 1 156 6.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174398
AA Change: D471N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: D471N

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 111,592,717 (GRCm39) missense probably benign 0.44
IGL01631:Cog4 APN 8 111,608,472 (GRCm39) missense probably damaging 1.00
IGL01756:Cog4 APN 8 111,580,391 (GRCm39) nonsense probably null
IGL02850:Cog4 APN 8 111,593,221 (GRCm39) missense possibly damaging 0.46
IGL02932:Cog4 APN 8 111,579,065 (GRCm39) missense probably benign 0.16
IGL03232:Cog4 APN 8 111,607,314 (GRCm39) splice site probably null
Deminimis UTSW 8 111,608,112 (GRCm39) missense probably damaging 0.98
R0350:Cog4 UTSW 8 111,580,328 (GRCm39) missense possibly damaging 0.73
R1368:Cog4 UTSW 8 111,585,157 (GRCm39) unclassified probably benign
R1531:Cog4 UTSW 8 111,606,353 (GRCm39) missense probably benign 0.30
R2110:Cog4 UTSW 8 111,585,214 (GRCm39) missense possibly damaging 0.62
R2112:Cog4 UTSW 8 111,585,214 (GRCm39) missense possibly damaging 0.62
R2867:Cog4 UTSW 8 111,593,291 (GRCm39) intron probably benign
R4239:Cog4 UTSW 8 111,585,244 (GRCm39) missense probably damaging 0.98
R4867:Cog4 UTSW 8 111,593,242 (GRCm39) missense probably damaging 1.00
R4967:Cog4 UTSW 8 111,578,915 (GRCm39) splice site probably null
R5124:Cog4 UTSW 8 111,573,825 (GRCm39) missense probably damaging 1.00
R5655:Cog4 UTSW 8 111,589,939 (GRCm39) missense probably damaging 1.00
R6024:Cog4 UTSW 8 111,608,112 (GRCm39) missense probably damaging 0.98
R6347:Cog4 UTSW 8 111,607,275 (GRCm39) missense probably damaging 1.00
R6475:Cog4 UTSW 8 111,607,526 (GRCm39) missense possibly damaging 0.74
R6526:Cog4 UTSW 8 111,608,418 (GRCm39) missense probably damaging 1.00
R6542:Cog4 UTSW 8 111,577,994 (GRCm39) missense probably damaging 1.00
R6545:Cog4 UTSW 8 111,607,577 (GRCm39) missense probably damaging 1.00
R7248:Cog4 UTSW 8 111,608,834 (GRCm39) missense unknown
R7292:Cog4 UTSW 8 111,608,460 (GRCm39) missense probably damaging 1.00
R7356:Cog4 UTSW 8 111,576,498 (GRCm39) critical splice acceptor site probably null
R7440:Cog4 UTSW 8 111,606,338 (GRCm39) missense probably benign 0.06
R7751:Cog4 UTSW 8 111,607,600 (GRCm39) missense probably damaging 1.00
R8170:Cog4 UTSW 8 111,592,663 (GRCm39) missense probably damaging 0.98
R8181:Cog4 UTSW 8 111,578,717 (GRCm39) splice site probably null
R8834:Cog4 UTSW 8 111,608,049 (GRCm39) missense probably damaging 1.00
R8837:Cog4 UTSW 8 111,579,004 (GRCm39) missense probably benign 0.45
R9155:Cog4 UTSW 8 111,608,384 (GRCm39) missense probably damaging 1.00
R9469:Cog4 UTSW 8 111,608,804 (GRCm39) missense unknown
Z1177:Cog4 UTSW 8 111,605,647 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGAGACAGGACTAGTATAACC -3'
(R):5'- AGCTAAGGATGTTGCATTTGGAAC -3'

Sequencing Primer
(F):5'- ACAGGACTAGTATAACCAGAACTATC -3'
(R):5'- GGCTGGCCTTAAACTCAGAGATC -3'
Posted On 2019-06-07