Incidental Mutation 'PIT4362001:Cog4'
ID 554627
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Name component of oligomeric golgi complex 4
Synonyms D8Ertd515e
Accession Numbers

Genbank: NM_133973; MGI: 2142808  
Essential gene? Probably essential (E-score: 0.953) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 110846600-110882227 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110866672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 472 (D472N)
Ref Sequence ENSEMBL: ENSMUSP00000034203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679]
AlphaFold Q8R1U1
Predicted Effect probably damaging
Transcript: ENSMUST00000034203
AA Change: D472N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: D472N

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165867
AA Change: D399N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: D399N

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172542
AA Change: D134N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753
AA Change: D134N

DomainStartEndE-ValueType
Pfam:COG4 1 156 6.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174398
AA Change: D471N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: D471N

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 110866085 missense probably benign 0.44
IGL01631:Cog4 APN 8 110881840 missense probably damaging 1.00
IGL01756:Cog4 APN 8 110853759 nonsense probably null
IGL02850:Cog4 APN 8 110866589 missense possibly damaging 0.46
IGL02932:Cog4 APN 8 110852433 missense probably benign 0.16
IGL03232:Cog4 APN 8 110880682 splice site probably null
Deminimis UTSW 8 110881480 missense probably damaging 0.98
R0350:Cog4 UTSW 8 110853696 missense possibly damaging 0.73
R1368:Cog4 UTSW 8 110858525 unclassified probably benign
R1531:Cog4 UTSW 8 110879721 missense probably benign 0.30
R2110:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2112:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2867:Cog4 UTSW 8 110866659 intron probably benign
R4239:Cog4 UTSW 8 110858612 missense probably damaging 0.98
R4867:Cog4 UTSW 8 110866610 missense probably damaging 1.00
R4967:Cog4 UTSW 8 110852283 splice site probably null
R5124:Cog4 UTSW 8 110847193 missense probably damaging 1.00
R5655:Cog4 UTSW 8 110863307 missense probably damaging 1.00
R6024:Cog4 UTSW 8 110881480 missense probably damaging 0.98
R6347:Cog4 UTSW 8 110880643 missense probably damaging 1.00
R6475:Cog4 UTSW 8 110880894 missense possibly damaging 0.74
R6526:Cog4 UTSW 8 110881786 missense probably damaging 1.00
R6542:Cog4 UTSW 8 110851362 missense probably damaging 1.00
R6545:Cog4 UTSW 8 110880945 missense probably damaging 1.00
R7248:Cog4 UTSW 8 110882202 missense unknown
R7292:Cog4 UTSW 8 110881828 missense probably damaging 1.00
R7356:Cog4 UTSW 8 110849866 critical splice acceptor site probably null
R7440:Cog4 UTSW 8 110879706 missense probably benign 0.06
R7751:Cog4 UTSW 8 110880968 missense probably damaging 1.00
R8170:Cog4 UTSW 8 110866031 missense probably damaging 0.98
R8181:Cog4 UTSW 8 110852085 splice site probably null
R8834:Cog4 UTSW 8 110881417 missense probably damaging 1.00
R8837:Cog4 UTSW 8 110852372 missense probably benign 0.45
R9155:Cog4 UTSW 8 110881752 missense probably damaging 1.00
R9469:Cog4 UTSW 8 110882172 missense unknown
Z1177:Cog4 UTSW 8 110879015 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGAGACAGGACTAGTATAACC -3'
(R):5'- AGCTAAGGATGTTGCATTTGGAAC -3'

Sequencing Primer
(F):5'- ACAGGACTAGTATAACCAGAACTATC -3'
(R):5'- GGCTGGCCTTAAACTCAGAGATC -3'
Posted On 2019-06-07