Incidental Mutation 'PIT4362001:Or8c20'
ID 554630
Institutional Source Beutler Lab
Gene Symbol Or8c20
Ensembl Gene ENSMUSG00000094588
Gene Name olfactory receptor family 8 subfamily C member 20
Synonyms GA_x6K02T2PVTD-32037624-32038565, MOR170-3, Olfr898
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 38260381-38261331 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38260494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 32 (L32F)
Ref Sequence ENSEMBL: ENSMUSP00000149554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076504] [ENSMUST00000216304] [ENSMUST00000217063]
AlphaFold L7N1Z5
Predicted Effect probably benign
Transcript: ENSMUST00000076504
AA Change: L38F

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075824
Gene: ENSMUSG00000094588
AA Change: L38F

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.2e-47 PFAM
Pfam:7tm_1 47 313 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216304
AA Change: L32F

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217063
AA Change: L32F

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Or8c20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Or8c20 APN 9 38,261,101 (GRCm39) missense possibly damaging 0.95
IGL02477:Or8c20 APN 9 38,260,421 (GRCm39) missense probably benign 0.16
IGL02858:Or8c20 APN 9 38,260,469 (GRCm39) missense probably benign 0.04
R0060:Or8c20 UTSW 9 38,260,808 (GRCm39) missense probably benign 0.23
R0518:Or8c20 UTSW 9 38,260,499 (GRCm39) missense probably damaging 0.99
R0521:Or8c20 UTSW 9 38,260,499 (GRCm39) missense probably damaging 0.99
R0622:Or8c20 UTSW 9 38,260,667 (GRCm39) missense possibly damaging 0.74
R0898:Or8c20 UTSW 9 38,260,738 (GRCm39) missense probably damaging 0.97
R1562:Or8c20 UTSW 9 38,260,658 (GRCm39) nonsense probably null
R3903:Or8c20 UTSW 9 38,260,954 (GRCm39) nonsense probably null
R4375:Or8c20 UTSW 9 38,260,465 (GRCm39) missense probably benign
R4459:Or8c20 UTSW 9 38,261,288 (GRCm39) missense probably damaging 1.00
R4762:Or8c20 UTSW 9 38,260,577 (GRCm39) missense probably damaging 1.00
R4943:Or8c20 UTSW 9 38,260,924 (GRCm39) missense probably damaging 1.00
R5033:Or8c20 UTSW 9 38,260,924 (GRCm39) missense probably damaging 1.00
R5442:Or8c20 UTSW 9 38,261,158 (GRCm39) missense probably benign 0.06
R5863:Or8c20 UTSW 9 38,261,083 (GRCm39) missense probably benign 0.09
R5988:Or8c20 UTSW 9 38,261,045 (GRCm39) missense probably benign 0.30
R7077:Or8c20 UTSW 9 38,261,266 (GRCm39) missense probably damaging 1.00
R7509:Or8c20 UTSW 9 38,260,868 (GRCm39) missense probably benign 0.26
R7709:Or8c20 UTSW 9 38,260,573 (GRCm39) missense probably benign 0.02
R9305:Or8c20 UTSW 9 38,260,381 (GRCm39) start codon destroyed probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGTGTGTTCAATAACTCCAAACCC -3'
(R):5'- AGATGGTGTTGTGCTCTGAAAC -3'

Sequencing Primer
(F):5'- TGTTCAATAACTCCAAACCCAGTTAG -3'
(R):5'- GGTGTTGTGCTCTGAAACAAAACTC -3'
Posted On 2019-06-07