Incidental Mutation 'PIT4362001:Olfr898'
ID554630
Institutional Source Beutler Lab
Gene Symbol Olfr898
Ensembl Gene ENSMUSG00000094588
Gene Nameolfactory receptor 898
SynonymsGA_x6K02T2PVTD-32037624-32038565, MOR170-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38348411-38352919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38349198 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 32 (L32F)
Ref Sequence ENSEMBL: ENSMUSP00000149554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076504] [ENSMUST00000216304] [ENSMUST00000217063]
Predicted Effect probably benign
Transcript: ENSMUST00000076504
AA Change: L38F

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075824
Gene: ENSMUSG00000094588
AA Change: L38F

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.2e-47 PFAM
Pfam:7tm_1 47 313 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216304
AA Change: L32F

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217063
AA Change: L32F

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Olfr898
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr898 APN 9 38349805 missense possibly damaging 0.95
IGL02477:Olfr898 APN 9 38349125 missense probably benign 0.16
IGL02858:Olfr898 APN 9 38349173 missense probably benign 0.04
R0060:Olfr898 UTSW 9 38349512 missense probably benign 0.23
R0518:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0521:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0622:Olfr898 UTSW 9 38349371 missense possibly damaging 0.74
R0898:Olfr898 UTSW 9 38349442 missense probably damaging 0.97
R1562:Olfr898 UTSW 9 38349362 nonsense probably null
R3903:Olfr898 UTSW 9 38349658 nonsense probably null
R4375:Olfr898 UTSW 9 38349169 missense probably benign
R4459:Olfr898 UTSW 9 38349992 missense probably damaging 1.00
R4762:Olfr898 UTSW 9 38349281 missense probably damaging 1.00
R4943:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5033:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5442:Olfr898 UTSW 9 38349862 missense probably benign 0.06
R5863:Olfr898 UTSW 9 38349787 missense probably benign 0.09
R5988:Olfr898 UTSW 9 38349749 missense probably benign 0.30
R7077:Olfr898 UTSW 9 38349970 missense probably damaging 1.00
R7509:Olfr898 UTSW 9 38349572 missense probably benign 0.26
R7709:Olfr898 UTSW 9 38349277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGTGTTCAATAACTCCAAACCC -3'
(R):5'- AGATGGTGTTGTGCTCTGAAAC -3'

Sequencing Primer
(F):5'- TGTTCAATAACTCCAAACCCAGTTAG -3'
(R):5'- GGTGTTGTGCTCTGAAACAAAACTC -3'
Posted On2019-06-07