Incidental Mutation 'PIT4362001:Cxcr6'
ID554632
Institutional Source Beutler Lab
Gene Symbol Cxcr6
Ensembl Gene ENSMUSG00000048521
Gene Namechemokine (C-X-C motif) receptor 6
SynonymsSTRL33, BONZO
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123806475-123811760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123810461 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 183 (I183F)
Ref Sequence ENSEMBL: ENSMUSP00000151182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]
Predicted Effect probably benign
Transcript: ENSMUST00000049810
AA Change: I176F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: I176F

DomainStartEndE-ValueType
Pfam:7tm_1 57 297 5.2e-43 PFAM
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000216072
AA Change: I183F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Cxcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Cxcr6 APN 9 123810705 missense probably damaging 0.96
IGL03192:Cxcr6 APN 9 123810046 missense possibly damaging 0.52
IGL03342:Cxcr6 APN 9 123810407 nonsense probably null
R0399:Cxcr6 UTSW 9 123810951 missense possibly damaging 0.70
R0487:Cxcr6 UTSW 9 123810398 missense probably benign 0.02
R1496:Cxcr6 UTSW 9 123810347 missense probably benign 0.12
R1662:Cxcr6 UTSW 9 123810548 missense possibly damaging 0.71
R1733:Cxcr6 UTSW 9 123810116 missense probably damaging 1.00
R1869:Cxcr6 UTSW 9 123809957 missense probably benign 0.37
R3055:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3056:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3771:Cxcr6 UTSW 9 123810485 missense probably benign 0.02
R3828:Cxcr6 UTSW 9 123810869 missense probably benign
R4810:Cxcr6 UTSW 9 123810162 missense probably damaging 1.00
R5685:Cxcr6 UTSW 9 123810746 missense probably benign 0.01
R5748:Cxcr6 UTSW 9 123810341 missense probably damaging 1.00
R6210:Cxcr6 UTSW 9 123810008 missense possibly damaging 0.95
R6612:Cxcr6 UTSW 9 123810720 missense probably damaging 1.00
R6773:Cxcr6 UTSW 9 123810290 missense possibly damaging 0.83
R7414:Cxcr6 UTSW 9 123810222 nonsense probably null
R7427:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7428:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7863:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
R8426:Cxcr6 UTSW 9 123810006 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATGAGTGGGTCTTTGGCAC -3'
(R):5'- TGCTTCTGGAAGTTTCGAGC -3'

Sequencing Primer
(F):5'- TGTGCAAAACTCTTCGAGGC -3'
(R):5'- CATGAAGCAAGGTCTTGATAATGCC -3'
Posted On2019-06-07