Incidental Mutation 'PIT4362001:Cxcr6'
ID 554632
Institutional Source Beutler Lab
Gene Symbol Cxcr6
Ensembl Gene ENSMUSG00000048521
Gene Name C-X-C motif chemokine receptor 6
Synonyms STRL33, BONZO
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 123635542-123640819 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123639526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 183 (I183F)
Ref Sequence ENSEMBL: ENSMUSP00000151182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]
AlphaFold Q9EQ16
Predicted Effect probably benign
Transcript: ENSMUST00000049810
AA Change: I176F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: I176F

DomainStartEndE-ValueType
Pfam:7tm_1 57 297 5.2e-43 PFAM
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000216072
AA Change: I183F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Cxcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Cxcr6 APN 9 123,639,770 (GRCm39) missense probably damaging 0.96
IGL03192:Cxcr6 APN 9 123,639,111 (GRCm39) missense possibly damaging 0.52
IGL03342:Cxcr6 APN 9 123,639,472 (GRCm39) nonsense probably null
R0399:Cxcr6 UTSW 9 123,640,016 (GRCm39) missense possibly damaging 0.70
R0487:Cxcr6 UTSW 9 123,639,463 (GRCm39) missense probably benign 0.02
R1496:Cxcr6 UTSW 9 123,639,412 (GRCm39) missense probably benign 0.12
R1662:Cxcr6 UTSW 9 123,639,613 (GRCm39) missense possibly damaging 0.71
R1733:Cxcr6 UTSW 9 123,639,181 (GRCm39) missense probably damaging 1.00
R1869:Cxcr6 UTSW 9 123,639,022 (GRCm39) missense probably benign 0.37
R3055:Cxcr6 UTSW 9 123,639,529 (GRCm39) missense probably damaging 1.00
R3056:Cxcr6 UTSW 9 123,639,529 (GRCm39) missense probably damaging 1.00
R3771:Cxcr6 UTSW 9 123,639,550 (GRCm39) missense probably benign 0.02
R3828:Cxcr6 UTSW 9 123,639,934 (GRCm39) missense probably benign
R4810:Cxcr6 UTSW 9 123,639,227 (GRCm39) missense probably damaging 1.00
R5685:Cxcr6 UTSW 9 123,639,811 (GRCm39) missense probably benign 0.01
R5748:Cxcr6 UTSW 9 123,639,406 (GRCm39) missense probably damaging 1.00
R6210:Cxcr6 UTSW 9 123,639,073 (GRCm39) missense possibly damaging 0.95
R6612:Cxcr6 UTSW 9 123,639,785 (GRCm39) missense probably damaging 1.00
R6773:Cxcr6 UTSW 9 123,639,355 (GRCm39) missense possibly damaging 0.83
R7414:Cxcr6 UTSW 9 123,639,287 (GRCm39) nonsense probably null
R7427:Cxcr6 UTSW 9 123,639,305 (GRCm39) missense probably benign 0.41
R7428:Cxcr6 UTSW 9 123,639,305 (GRCm39) missense probably benign 0.41
R7863:Cxcr6 UTSW 9 123,639,914 (GRCm39) missense probably damaging 0.98
R8426:Cxcr6 UTSW 9 123,639,071 (GRCm39) missense probably benign 0.00
R8824:Cxcr6 UTSW 9 123,640,006 (GRCm39) missense probably benign 0.08
R9645:Cxcr6 UTSW 9 123,639,151 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CCTATGAGTGGGTCTTTGGCAC -3'
(R):5'- TGCTTCTGGAAGTTTCGAGC -3'

Sequencing Primer
(F):5'- TGTGCAAAACTCTTCGAGGC -3'
(R):5'- CATGAAGCAAGGTCTTGATAATGCC -3'
Posted On 2019-06-07