Incidental Mutation 'PIT4362001:Atad5'
ID 554638
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene Name ATPase family, AAA domain containing 5
Synonyms LOC237877, C130052G03Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79980226-80026620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80002393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1062 (H1062Y)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
AlphaFold Q4QY64
Predicted Effect probably benign
Transcript: ENSMUST00000017694
AA Change: H1062Y

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: H1062Y

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108239
AA Change: H1062Y

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: H1062Y

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80,023,684 (GRCm39) missense probably benign 0.22
IGL00916:Atad5 APN 11 80,009,826 (GRCm39) missense probably damaging 1.00
IGL01348:Atad5 APN 11 79,986,390 (GRCm39) missense probably benign 0.00
IGL01601:Atad5 APN 11 79,986,343 (GRCm39) missense probably benign 0.45
IGL01916:Atad5 APN 11 80,003,665 (GRCm39) critical splice donor site probably null
IGL02028:Atad5 APN 11 80,024,936 (GRCm39) missense probably benign 0.20
IGL02095:Atad5 APN 11 79,985,533 (GRCm39) missense probably benign 0.24
IGL02142:Atad5 APN 11 79,985,023 (GRCm39) missense probably benign 0.00
IGL02206:Atad5 APN 11 79,985,009 (GRCm39) missense probably damaging 1.00
IGL02385:Atad5 APN 11 79,985,453 (GRCm39) missense probably benign 0.04
IGL02858:Atad5 APN 11 79,980,601 (GRCm39) missense probably damaging 1.00
IGL02962:Atad5 APN 11 79,999,405 (GRCm39) missense possibly damaging 0.86
R0040:Atad5 UTSW 11 79,988,840 (GRCm39) missense probably benign
R0157:Atad5 UTSW 11 79,980,643 (GRCm39) missense possibly damaging 0.74
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0319:Atad5 UTSW 11 80,011,616 (GRCm39) splice site probably benign
R0401:Atad5 UTSW 11 80,011,525 (GRCm39) missense probably benign 0.11
R0426:Atad5 UTSW 11 80,003,658 (GRCm39) missense probably benign 0.14
R0452:Atad5 UTSW 11 79,997,247 (GRCm39) missense probably damaging 0.98
R0496:Atad5 UTSW 11 79,991,182 (GRCm39) missense probably benign 0.08
R1691:Atad5 UTSW 11 79,986,358 (GRCm39) missense probably benign 0.00
R1812:Atad5 UTSW 11 80,023,873 (GRCm39) missense probably damaging 0.98
R2070:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2071:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2153:Atad5 UTSW 11 79,997,203 (GRCm39) missense probably benign 0.04
R2415:Atad5 UTSW 11 79,985,077 (GRCm39) missense probably damaging 1.00
R3917:Atad5 UTSW 11 79,994,120 (GRCm39) missense probably null 0.97
R4025:Atad5 UTSW 11 80,011,512 (GRCm39) missense probably damaging 1.00
R4464:Atad5 UTSW 11 79,991,137 (GRCm39) splice site probably null
R4561:Atad5 UTSW 11 79,986,715 (GRCm39) missense probably benign 0.01
R4579:Atad5 UTSW 11 79,986,017 (GRCm39) missense probably damaging 1.00
R4844:Atad5 UTSW 11 80,005,137 (GRCm39) splice site probably null
R4853:Atad5 UTSW 11 79,986,098 (GRCm39) missense probably damaging 1.00
R4873:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R4875:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R5054:Atad5 UTSW 11 79,985,502 (GRCm39) missense probably benign 0.10
R5226:Atad5 UTSW 11 79,985,888 (GRCm39) missense probably damaging 0.99
R5397:Atad5 UTSW 11 80,002,319 (GRCm39) missense probably damaging 1.00
R5449:Atad5 UTSW 11 80,014,934 (GRCm39) missense probably damaging 1.00
R5571:Atad5 UTSW 11 80,002,382 (GRCm39) missense probably benign 0.05
R5575:Atad5 UTSW 11 79,991,149 (GRCm39) missense probably benign 0.02
R5857:Atad5 UTSW 11 80,022,155 (GRCm39) missense probably benign 0.06
R5927:Atad5 UTSW 11 80,018,111 (GRCm39) missense probably damaging 1.00
R5928:Atad5 UTSW 11 79,985,003 (GRCm39) missense probably damaging 1.00
R5949:Atad5 UTSW 11 79,986,835 (GRCm39) nonsense probably null
R6102:Atad5 UTSW 11 80,002,398 (GRCm39) critical splice donor site probably null
R6254:Atad5 UTSW 11 80,018,215 (GRCm39) missense probably damaging 0.96
R6562:Atad5 UTSW 11 80,024,032 (GRCm39) missense probably benign 0.26
R6744:Atad5 UTSW 11 80,024,858 (GRCm39) missense probably benign 0.00
R7092:Atad5 UTSW 11 80,011,546 (GRCm39) missense possibly damaging 0.68
R7202:Atad5 UTSW 11 79,980,601 (GRCm39) missense probably damaging 1.00
R7345:Atad5 UTSW 11 79,986,832 (GRCm39) missense probably damaging 1.00
R7352:Atad5 UTSW 11 79,994,169 (GRCm39) critical splice donor site probably null
R7358:Atad5 UTSW 11 80,023,862 (GRCm39) missense probably benign 0.32
R7420:Atad5 UTSW 11 79,986,688 (GRCm39) missense probably benign 0.06
R7453:Atad5 UTSW 11 80,009,969 (GRCm39) critical splice donor site probably null
R7990:Atad5 UTSW 11 80,024,079 (GRCm39) nonsense probably null
R8012:Atad5 UTSW 11 79,985,066 (GRCm39) missense probably damaging 1.00
R8152:Atad5 UTSW 11 79,985,996 (GRCm39) missense possibly damaging 0.59
R8421:Atad5 UTSW 11 79,985,384 (GRCm39) missense probably damaging 0.98
R8842:Atad5 UTSW 11 80,000,910 (GRCm39) missense possibly damaging 0.87
R8918:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.02
R8943:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R8944:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R9134:Atad5 UTSW 11 80,023,931 (GRCm39) missense probably benign 0.00
R9137:Atad5 UTSW 11 79,986,481 (GRCm39) missense probably damaging 1.00
R9301:Atad5 UTSW 11 79,986,845 (GRCm39) missense probably damaging 1.00
R9372:Atad5 UTSW 11 79,985,094 (GRCm39) missense possibly damaging 0.68
R9404:Atad5 UTSW 11 80,005,064 (GRCm39) missense probably damaging 1.00
R9443:Atad5 UTSW 11 80,023,388 (GRCm39) missense probably benign 0.01
R9471:Atad5 UTSW 11 80,023,524 (GRCm39) missense possibly damaging 0.65
R9577:Atad5 UTSW 11 80,004,996 (GRCm39) missense probably damaging 1.00
R9656:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9659:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9661:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
RF003:Atad5 UTSW 11 80,002,386 (GRCm39) missense probably damaging 0.99
X0024:Atad5 UTSW 11 80,023,609 (GRCm39) missense probably benign 0.02
Z1176:Atad5 UTSW 11 79,985,722 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGAGATTAAAGCTGTGT -3'
(R):5'- CACAGTGAAACCCAGTCTTGAAAA -3'

Sequencing Primer
(F):5'- GCTGAGATTAAAGCTGTGTGATTG -3'
(R):5'- TAAATGGAAGGAAAGAAGGAAGAAAG -3'
Posted On 2019-06-07