Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Grin2c'

554641

Institutional Source

Beutler Lab

Gene Symbol

Grin2c

Ensembl Gene

ENSMUSG00000020734

Gene Name

glutamate receptor, ionotropic, NMDA2C (epsilon 3)

Synonyms

NR2C, GluRepsilon3, NMDAR2C

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.356) question?

Stock #

PIT4362001 (G1)

Quality Score

212.009

Status

Not validated

Chromosome

Chromosomal Location

115249169-115267243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115249633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1220 (T1220A)

Ref Sequence

ENSEMBL: ENSMUSP00000003351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000061450] [ENSMUST00000100235] [ENSMUST00000106554]

AlphaFold

Q01098

Predicted Effect

probably benign
Transcript: ENSMUST00000003351
AA Change: T1220A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: T1220A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	99	299	5.1e-12	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	924	6.8e-15	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000061450

SMART Domains

Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	77	3.4e-10	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	128	487	4.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100235

SMART Domains

Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	81	5.5e-11	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	127	485	1.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106554
AA Change: T1220A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: T1220A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	100	306	6.9e-10	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	926	1.1e-13	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Aox2	A	T	1: 58,282,680	T44S	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Chuk	A	G	19: 44,098,583		probably null	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pde6b	T	C	5: 108,423,585		probably null	Het
Pdzrn4	A	T	15: 92,769,881	D638V	possibly damaging	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Vil1	G	A	1: 74,421,383	R233H	probably damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Grin2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Grin2c	APN	11	115258110	missense	possibly damaging	0.94
IGL01306:Grin2c	APN	11	115256194	missense	probably benign	0.01
IGL01408:Grin2c	APN	11	115260882	missense	probably damaging	1.00
IGL01539:Grin2c	APN	11	115250106	missense	probably benign	0.32
IGL01931:Grin2c	APN	11	115253910	missense	probably damaging	1.00
IGL01964:Grin2c	APN	11	115253847	missense	probably damaging	1.00
IGL02796:Grin2c	APN	11	115250717	splice site	probably benign
IGL02956:Grin2c	APN	11	115257959	missense	possibly damaging	0.86
IGL03221:Grin2c	APN	11	115254044	splice site	probably benign
ANU23:Grin2c	UTSW	11	115256194	missense	probably benign	0.01
BB007:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
BB017:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0112:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R0355:Grin2c	UTSW	11	115260728	splice site	probably benign
R0681:Grin2c	UTSW	11	115249653	missense	probably benign
R0791:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R0792:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R1512:Grin2c	UTSW	11	115253850	missense	probably damaging	1.00
R1572:Grin2c	UTSW	11	115256074	missense	possibly damaging	0.92
R1654:Grin2c	UTSW	11	115260853	missense	probably benign	0.21
R1803:Grin2c	UTSW	11	115260732	critical splice donor site	probably null
R1982:Grin2c	UTSW	11	115260905	missense	possibly damaging	0.96
R2050:Grin2c	UTSW	11	115257419	missense	possibly damaging	0.89
R2196:Grin2c	UTSW	11	115250666	missense	probably benign	0.34
R2442:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R2509:Grin2c	UTSW	11	115251068	nonsense	probably null
R3440:Grin2c	UTSW	11	115250643	missense	probably damaging	1.00
R3965:Grin2c	UTSW	11	115260994	missense	probably damaging	1.00
R4618:Grin2c	UTSW	11	115252747	missense	probably damaging	1.00
R4735:Grin2c	UTSW	11	115249596	missense	possibly damaging	0.63
R4856:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R4886:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R5277:Grin2c	UTSW	11	115253813	missense	probably damaging	1.00
R5334:Grin2c	UTSW	11	115256055	missense	possibly damaging	0.76
R5553:Grin2c	UTSW	11	115252725	missense	probably null	0.96
R5711:Grin2c	UTSW	11	115250289	missense	probably benign	0.32
R5784:Grin2c	UTSW	11	115258295	missense	possibly damaging	0.94
R5849:Grin2c	UTSW	11	115260991	missense	probably benign
R6421:Grin2c	UTSW	11	115251130	missense	probably damaging	1.00
R6461:Grin2c	UTSW	11	115255696	missense	possibly damaging	0.96
R6658:Grin2c	UTSW	11	115258282	missense	possibly damaging	0.64
R7205:Grin2c	UTSW	11	115251050	missense	probably damaging	0.99
R7611:Grin2c	UTSW	11	115252685	missense	probably damaging	1.00
R7637:Grin2c	UTSW	11	115256259	splice site	probably null
R7751:Grin2c	UTSW	11	115253870	missense	probably damaging	1.00
R7847:Grin2c	UTSW	11	115260978	missense	possibly damaging	0.68
R7920:Grin2c	UTSW	11	115254144	missense	probably benign	0.33
R7930:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
R7940:Grin2c	UTSW	11	115255281	missense	probably damaging	1.00
R7956:Grin2c	UTSW	11	115250148	missense	probably benign	0.16
R8081:Grin2c	UTSW	11	115249893	missense	probably damaging	0.98
R8249:Grin2c	UTSW	11	115253837	missense	probably damaging	0.98
R8447:Grin2c	UTSW	11	115257389	missense	probably benign	0.01
R9034:Grin2c	UTSW	11	115251239	missense	probably damaging	1.00
R9409:Grin2c	UTSW	11	115253280	missense	probably benign	0.06
R9432:Grin2c	UTSW	11	115251226	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTCTCATGGCCAGAATTTCAAAG -3'
(R):5'- TCAAACACAGTCGTTGCGG -3'

Sequencing Primer
(F):5'- TCATGGCCAGAATTTCAAAGAAGAAG -3'
(R):5'- GCATGTCTGCCTGCACAC -3'

Posted On

2019-06-07