Incidental Mutation 'PIT4362001:Snx6'
ID 554643
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Name sorting nexin 6
Synonyms 2010006G21Rik, 2610032J07Rik, 2810425K19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.832) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 54793124-54842464 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54814815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 169 (Y169H)
Ref Sequence ENSEMBL: ENSMUSP00000005798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934] [ENSMUST00000219781]
AlphaFold Q6P8X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000005798
AA Change: Y169H

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: Y169H

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218934
AA Change: Y53H

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219781
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54,801,094 (GRCm39) missense probably damaging 0.99
IGL02682:Snx6 APN 12 54,801,130 (GRCm39) missense probably damaging 1.00
IGL02995:Snx6 APN 12 54,842,295 (GRCm39) splice site probably benign
IGL03240:Snx6 APN 12 54,830,228 (GRCm39) missense probably damaging 0.98
IGL03353:Snx6 APN 12 54,812,469 (GRCm39) splice site probably benign
R0458:Snx6 UTSW 12 54,814,921 (GRCm39) nonsense probably null
R0610:Snx6 UTSW 12 54,798,574 (GRCm39) missense probably damaging 1.00
R0689:Snx6 UTSW 12 54,810,441 (GRCm39) missense probably benign 0.00
R1818:Snx6 UTSW 12 54,830,259 (GRCm39) missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54,830,259 (GRCm39) missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54,817,528 (GRCm39) missense probably damaging 1.00
R5275:Snx6 UTSW 12 54,830,807 (GRCm39) missense probably damaging 1.00
R5373:Snx6 UTSW 12 54,817,513 (GRCm39) missense probably damaging 0.99
R5374:Snx6 UTSW 12 54,817,513 (GRCm39) missense probably damaging 0.99
R5497:Snx6 UTSW 12 54,803,846 (GRCm39) missense probably damaging 0.98
R5907:Snx6 UTSW 12 54,801,104 (GRCm39) missense probably damaging 1.00
R5947:Snx6 UTSW 12 54,817,549 (GRCm39) nonsense probably null
R6178:Snx6 UTSW 12 54,807,249 (GRCm39) missense probably damaging 0.99
R6287:Snx6 UTSW 12 54,793,813 (GRCm39) missense possibly damaging 0.75
R6321:Snx6 UTSW 12 54,798,798 (GRCm39) missense probably damaging 1.00
R6878:Snx6 UTSW 12 54,810,386 (GRCm39) splice site probably null
R7055:Snx6 UTSW 12 54,830,864 (GRCm39) missense probably damaging 1.00
R8227:Snx6 UTSW 12 54,798,756 (GRCm39) missense possibly damaging 0.82
R8899:Snx6 UTSW 12 54,812,423 (GRCm39) missense probably benign 0.06
R9606:Snx6 UTSW 12 54,814,811 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAAGCATTCATTCGGACCCTG -3'
(R):5'- AGCTTGGGACGACTTTGTAG -3'

Sequencing Primer
(F):5'- TGGCAACTAAAGTGTTACCTCCAGG -3'
(R):5'- GGACGACTTTGTAGTTGAATCC -3'
Posted On 2019-06-07