Incidental Mutation 'PIT4362001:Gm4787'
ID554646
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81377175 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 736 (L736F)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: L736F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: L736F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACACAATGCTAATTCCCAGTG -3'
(R):5'- TCACTGTGTTCAAGGTTGGC -3'

Sequencing Primer
(F):5'- CATGACTGATGGGAGACA -3'
(R):5'- TTGGCAACCACCAAAATGTTTAC -3'
Posted On2019-06-07