Incidental Mutation 'PIT4362001:Pcdh20'
ID 554651
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Name protocadherin 20
Synonyms PCDH13, C630015B17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 88702183-88708832 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 88704462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 946 (P946R)
Ref Sequence ENSEMBL: ENSMUSP00000054774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
AlphaFold Q8BIZ0
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: P946R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: P946R

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: P946R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: P946R

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Ephb3 A G 16: 21,039,607 (GRCm39) E707G probably damaging Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88,705,317 (GRCm39) missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88,704,636 (GRCm39) missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88,708,344 (GRCm39) missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88,707,031 (GRCm39) missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88,706,280 (GRCm39) missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88,704,438 (GRCm39) utr 3 prime probably benign
PIT4403001:Pcdh20 UTSW 14 88,704,462 (GRCm39) missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88,704,744 (GRCm39) missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88,706,383 (GRCm39) missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88,706,439 (GRCm39) missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88,706,104 (GRCm39) missense probably benign
R0575:Pcdh20 UTSW 14 88,705,048 (GRCm39) missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88,706,226 (GRCm39) missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88,705,737 (GRCm39) missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88,706,673 (GRCm39) missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88,706,673 (GRCm39) missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88,705,758 (GRCm39) missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88,705,410 (GRCm39) missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88,706,620 (GRCm39) missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88,706,140 (GRCm39) missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88,704,591 (GRCm39) missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88,704,984 (GRCm39) missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88,704,672 (GRCm39) missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88,705,899 (GRCm39) missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88,705,615 (GRCm39) missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88,706,434 (GRCm39) missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88,705,866 (GRCm39) missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88,705,052 (GRCm39) missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88,705,104 (GRCm39) missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88,707,162 (GRCm39) missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88,706,351 (GRCm39) missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88,705,813 (GRCm39) missense probably benign
R5652:Pcdh20 UTSW 14 88,704,760 (GRCm39) missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88,708,312 (GRCm39) missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88,705,488 (GRCm39) missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88,705,488 (GRCm39) missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88,704,690 (GRCm39) missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88,706,038 (GRCm39) missense probably benign
R7044:Pcdh20 UTSW 14 88,706,607 (GRCm39) missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88,706,511 (GRCm39) missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88,706,103 (GRCm39) missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88,706,050 (GRCm39) missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88,706,589 (GRCm39) missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88,706,803 (GRCm39) missense probably benign
R7706:Pcdh20 UTSW 14 88,704,793 (GRCm39) missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88,707,143 (GRCm39) missense probably null 0.02
R7892:Pcdh20 UTSW 14 88,704,867 (GRCm39) nonsense probably null
R8218:Pcdh20 UTSW 14 88,706,047 (GRCm39) missense probably damaging 0.96
R8545:Pcdh20 UTSW 14 88,706,601 (GRCm39) missense probably damaging 0.96
R8701:Pcdh20 UTSW 14 88,705,849 (GRCm39) missense possibly damaging 0.95
R9219:Pcdh20 UTSW 14 88,706,255 (GRCm39) missense probably benign 0.01
R9238:Pcdh20 UTSW 14 88,706,190 (GRCm39) missense probably benign 0.43
R9418:Pcdh20 UTSW 14 88,705,455 (GRCm39) missense probably benign
R9665:Pcdh20 UTSW 14 88,707,162 (GRCm39) missense probably benign 0.44
X0028:Pcdh20 UTSW 14 88,705,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGCCAGTTATATCCAAC -3'
(R):5'- ATGCCCACATTGGTAGCTCTG -3'

Sequencing Primer
(F):5'- GCTGCCAGTTATATCCAACATTTTAC -3'
(R):5'- CATTGGTAGCTCTGTCAGTCATAAGC -3'
Posted On 2019-06-07