Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Pdzrn4'

554653

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

PIT4362001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92769881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 638 (D638V)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: D399V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: D399V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169942
AA Change: D638V

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: D638V

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Aox2	A	T	1: 58,282,680	T44S	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Chuk	A	G	19: 44,098,583		probably null	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grin2c	T	C	11: 115,249,633	T1220A	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pde6b	T	C	5: 108,423,585		probably null	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Vil1	G	A	1: 74,421,383	R233H	probably damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAATGCAGTGAGAGTTGTGC -3'
(R):5'- TCGAGCTGTCCTTGTCTGAC -3'

Sequencing Primer
(F):5'- CTGGGGGTGAGTGCTTAGACTC -3'
(R):5'- GGTGTTCCATGATGTCATCCAG -3'

Posted On

2019-06-07