Incidental Mutation 'PIT4362001:Ephb3'
ID 554654
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene Name Eph receptor B3
Synonyms Cek10, Tyro6, Etk2, Sek4, MDK5, HEK2
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # PIT4362001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 21023530-21042054 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21039607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 707 (E707G)
Ref Sequence ENSEMBL: ENSMUSP00000006112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
AlphaFold P54754
Predicted Effect probably damaging
Transcript: ENSMUST00000006112
AA Change: E707G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: E707G

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161063
AA Change: E453G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,398 (GRCm39) S28P possibly damaging Het
Akr1c14 T C 13: 4,129,100 (GRCm39) V165A probably damaging Het
Aox1 A T 1: 58,321,839 (GRCm39) T44S probably damaging Het
Arhgap29 T A 3: 121,796,861 (GRCm39) N482K probably benign Het
Arhgef38 T A 3: 132,866,591 (GRCm39) D182V Het
Atad5 C T 11: 80,002,393 (GRCm39) H1062Y probably benign Het
Atp6v0b A G 4: 117,742,453 (GRCm39) S147P possibly damaging Het
Cblb T A 16: 51,959,905 (GRCm39) Y299* probably null Het
Ccdc28b T C 4: 129,514,818 (GRCm39) N97S probably benign Het
Cdh23 A G 10: 60,301,237 (GRCm39) V479A probably benign Het
Chuk A G 19: 44,087,022 (GRCm39) probably null Het
Cmtr2 G A 8: 110,948,968 (GRCm39) G426D probably damaging Het
Cog4 G A 8: 111,593,304 (GRCm39) D472N probably damaging Het
Creb3 T A 4: 43,565,472 (GRCm39) L193* probably null Het
Cxcr6 A T 9: 123,639,526 (GRCm39) I183F probably benign Het
Dbf4 A G 5: 8,453,664 (GRCm39) F253L probably benign Het
Dcaf8 T C 1: 172,000,364 (GRCm39) V174A probably damaging Het
Ddhd2 T C 8: 26,225,779 (GRCm39) Y526C probably damaging Het
Dnal4 A G 15: 79,647,766 (GRCm39) V33A probably benign Het
Egfl7 C T 2: 26,481,052 (GRCm39) P188L probably benign Het
Epn3 C T 11: 94,387,349 (GRCm39) R7H probably damaging Het
Fbp1 T A 13: 63,015,194 (GRCm39) I262F probably damaging Het
Fgfbp3 G A 19: 36,896,088 (GRCm39) R177* probably null Het
Gask1b C A 3: 79,794,246 (GRCm39) S238Y possibly damaging Het
Gbp5 T C 3: 142,206,471 (GRCm39) S52P probably damaging Het
Glb1l2 A T 9: 26,685,277 (GRCm39) S282T probably benign Het
Glg1 A T 8: 111,985,431 (GRCm39) V133E possibly damaging Het
Gm4787 T G 12: 81,423,949 (GRCm39) L736F probably benign Het
Gm5565 A T 5: 146,095,109 (GRCm39) S212R probably benign Het
Grin2c T C 11: 115,140,459 (GRCm39) T1220A probably benign Het
Grp T G 18: 66,019,297 (GRCm39) S133A probably benign Het
Gstp2 C A 19: 4,090,713 (GRCm39) D147Y possibly damaging Het
Igkv14-130 T C 6: 67,768,392 (GRCm39) F84L probably damaging Het
Inppl1 T C 7: 101,475,220 (GRCm39) R944G probably benign Het
Lama2 A T 10: 27,245,132 (GRCm39) N216K probably damaging Het
Lrp2 T A 2: 69,367,882 (GRCm39) D210V probably damaging Het
Lrrc2 A T 9: 110,791,608 (GRCm39) Q120L possibly damaging Het
Lrriq1 A G 10: 102,907,055 (GRCm39) I1555T probably benign Het
Map2 G A 1: 66,451,677 (GRCm39) G189D probably benign Het
Mdc1 A G 17: 36,155,361 (GRCm39) E12G possibly damaging Het
Mdga2 T C 12: 66,844,542 (GRCm39) D152G possibly damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mutyh G A 4: 116,674,267 (GRCm39) V273M probably damaging Het
Neurod2 T A 11: 98,218,708 (GRCm39) Y152F probably damaging Het
Or5d3 C T 2: 88,174,357 (GRCm39) A247T probably benign Het
Or5g25 A C 2: 85,478,068 (GRCm39) L199R probably damaging Het
Or8c20 G T 9: 38,260,494 (GRCm39) L32F probably benign Het
Pcdh20 G C 14: 88,704,462 (GRCm39) P946R probably damaging Het
Pde6b T C 5: 108,571,451 (GRCm39) probably null Het
Pdzrn4 A T 15: 92,667,762 (GRCm39) D638V possibly damaging Het
Polr1b A G 2: 128,951,212 (GRCm39) D275G possibly damaging Het
Rnf157 T A 11: 116,251,143 (GRCm39) D127V probably damaging Het
Rspo4 T A 2: 151,709,803 (GRCm39) C69* probably null Het
Scara3 T C 14: 66,173,851 (GRCm39) T63A probably benign Het
Scn2a G A 2: 65,514,182 (GRCm39) E289K probably benign Het
Sh3gl2 A G 4: 85,295,786 (GRCm39) T163A probably benign Het
Slc2a10 T A 2: 165,358,213 (GRCm39) F446Y probably damaging Het
Snapc1 C T 12: 74,029,269 (GRCm39) R351C probably damaging Het
Snx6 A G 12: 54,814,815 (GRCm39) Y169H possibly damaging Het
Stab2 A T 10: 86,697,299 (GRCm39) C1996* probably null Het
Steap4 A G 5: 8,030,337 (GRCm39) T398A probably benign Het
Tep1 A T 14: 51,103,510 (GRCm39) L260Q probably benign Het
Tspan12 A T 6: 21,835,463 (GRCm39) V70D possibly damaging Het
Ttn G A 2: 76,569,362 (GRCm39) A27177V probably damaging Het
Ube3a T C 7: 58,925,870 (GRCm39) V237A possibly damaging Het
Vil1 G A 1: 74,460,542 (GRCm39) R233H probably damaging Het
Xrcc5 A G 1: 72,433,088 (GRCm39) T716A probably benign Het
Zbp1 A G 2: 173,058,783 (GRCm39) I18T probably damaging Het
Zfp292 A G 4: 34,807,524 (GRCm39) V1845A probably benign Het
Zfp407 A T 18: 84,579,393 (GRCm39) N573K possibly damaging Het
Zfp64 T C 2: 168,767,735 (GRCm39) T626A probably benign Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21,039,165 (GRCm39) splice site probably null
IGL00966:Ephb3 APN 16 21,036,044 (GRCm39) missense probably benign 0.00
IGL02166:Ephb3 APN 16 21,039,499 (GRCm39) missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21,040,174 (GRCm39) missense probably benign 0.04
IGL02321:Ephb3 APN 16 21,033,139 (GRCm39) missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21,040,253 (GRCm39) splice site probably null
IGL02507:Ephb3 APN 16 21,039,389 (GRCm39) splice site probably benign
IGL02755:Ephb3 APN 16 21,040,448 (GRCm39) missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21,041,031 (GRCm39) missense probably benign 0.02
R0026:Ephb3 UTSW 16 21,033,667 (GRCm39) missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21,036,859 (GRCm39) missense probably benign 0.01
R0196:Ephb3 UTSW 16 21,036,804 (GRCm39) missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21,039,525 (GRCm39) missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21,037,784 (GRCm39) unclassified probably benign
R1126:Ephb3 UTSW 16 21,041,226 (GRCm39) missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21,037,672 (GRCm39) missense probably benign
R1592:Ephb3 UTSW 16 21,040,450 (GRCm39) missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21,031,687 (GRCm39) missense probably benign 0.00
R1694:Ephb3 UTSW 16 21,040,495 (GRCm39) missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21,039,400 (GRCm39) missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21,035,985 (GRCm39) missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21,041,045 (GRCm39) missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21,040,132 (GRCm39) missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21,036,993 (GRCm39) missense probably benign
R3408:Ephb3 UTSW 16 21,038,254 (GRCm39) missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21,040,447 (GRCm39) missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21,033,213 (GRCm39) missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21,040,958 (GRCm39) missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21,033,745 (GRCm39) missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21,033,745 (GRCm39) missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21,039,245 (GRCm39) missense probably benign 0.09
R5057:Ephb3 UTSW 16 21,039,197 (GRCm39) missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21,033,237 (GRCm39) missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21,037,855 (GRCm39) missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21,039,610 (GRCm39) missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21,036,869 (GRCm39) missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21,041,241 (GRCm39) missense probably benign 0.08
R5838:Ephb3 UTSW 16 21,040,437 (GRCm39) missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21,030,129 (GRCm39) intron probably benign
R6017:Ephb3 UTSW 16 21,040,781 (GRCm39) missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21,040,763 (GRCm39) missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21,036,861 (GRCm39) missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21,040,218 (GRCm39) missense probably benign
R6591:Ephb3 UTSW 16 21,033,223 (GRCm39) missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21,033,223 (GRCm39) missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21,037,268 (GRCm39) missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21,037,577 (GRCm39) nonsense probably null
R7236:Ephb3 UTSW 16 21,033,231 (GRCm39) missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21,040,976 (GRCm39) missense probably benign 0.04
R7410:Ephb3 UTSW 16 21,040,158 (GRCm39) missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21,033,457 (GRCm39) missense probably damaging 1.00
R7452:Ephb3 UTSW 16 21,036,107 (GRCm39) splice site probably null
R7944:Ephb3 UTSW 16 21,040,434 (GRCm39) missense probably damaging 1.00
R7945:Ephb3 UTSW 16 21,040,434 (GRCm39) missense probably damaging 1.00
R9092:Ephb3 UTSW 16 21,041,214 (GRCm39) missense probably benign 0.01
R9504:Ephb3 UTSW 16 21,036,830 (GRCm39) missense possibly damaging 0.48
R9706:Ephb3 UTSW 16 21,039,193 (GRCm39) missense probably damaging 1.00
Z1176:Ephb3 UTSW 16 21,036,786 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCGAGATGGGTGTAATGCTG -3'
(R):5'- AATCTTGTCTCCAACATCCCAGTG -3'

Sequencing Primer
(F):5'- TCGACTGAAACTGCCCGG -3'
(R):5'- CCAGCCCTAGTTTATAACTGAGG -3'
Posted On 2019-06-07