Incidental Mutation 'PIT4362001:Mdc1'
ID 554657
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # PIT4362001 (G1)
Quality Score 215.009
Status Not validated
Chromosome 17
Chromosomal Location 35841515-35859670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35844469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Ref Sequence ENSEMBL: ENSMUSP00000133568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082337
AA Change: E12G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174124
AA Change: E12G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7960:Mdc1 UTSW 17 35850678 nonsense probably null
R8350:Mdc1 UTSW 17 35848299 missense probably benign 0.00
R8450:Mdc1 UTSW 17 35848299 missense probably benign 0.00
R8688:Mdc1 UTSW 17 35850491 missense probably benign 0.10
R8726:Mdc1 UTSW 17 35847583 missense probably benign 0.04
R8919:Mdc1 UTSW 17 35847951 missense probably benign 0.00
R8961:Mdc1 UTSW 17 35848515 missense probably benign 0.10
R9324:Mdc1 UTSW 17 35853366 missense probably benign 0.10
R9363:Mdc1 UTSW 17 35851127 missense probably benign 0.00
R9385:Mdc1 UTSW 17 35850504 missense probably benign 0.00
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCCCTGAATATTGTTACATGC -3'
(R):5'- AACTCAGGTGGCCTCTTTGG -3'

Sequencing Primer
(F):5'- CCCCTGAATATTGTTACATGCTTTAG -3'
(R):5'- AGTGGTACAGTTATTCATATCCCC -3'
Posted On 2019-06-07