Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4362001:Chuk'

554662

Institutional Source

Beutler Lab

Gene Symbol

Chuk

Ensembl Gene

ENSMUSG00000025199

Gene Name

conserved helix-loop-helix ubiquitous kinase

Synonyms

Chuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4362001 (G1)

Quality Score

192.009

Status

Not validated

Chromosome

Chromosomal Location

44073335-44107480 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 44098583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000026217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000026217

SMART Domains

Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pkinase_Tyr	15	254	3.5e-39	PFAM
Pfam:Pkinase	15	298	8.3e-55	PFAM
Blast:PHB	589	659	1e-38	BLAST
IKKbetaNEMObind	706	743	1.64e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000119591

SMART Domains

Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pkinase_Tyr	15	253	9.1e-38	PFAM
Pfam:Pkinase	15	298	8.5e-54	PFAM
Blast:PHB	589	659	8e-39	BLAST

Coding Region Coverage

1x: 93.4%
3x: 91.2%
10x: 87.0%
20x: 78.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	T	C	17: 31,064,424	S28P	possibly damaging	Het
Akr1c14	T	C	13: 4,079,100	V165A	probably damaging	Het
Aox2	A	T	1: 58,282,680	T44S	probably damaging	Het
Arhgap29	T	A	3: 122,003,212	N482K	probably benign	Het
Arhgef38	T	A	3: 133,160,830	D182V		Het
Atad5	C	T	11: 80,111,567	H1062Y	probably benign	Het
Atp6v0b	A	G	4: 117,885,256	S147P	possibly damaging	Het
Cblb	T	A	16: 52,139,542	Y299*	probably null	Het
Ccdc28b	T	C	4: 129,621,025	N97S	probably benign	Het
Cdh23	A	G	10: 60,465,458	V479A	probably benign	Het
Cmtr2	G	A	8: 110,222,336	G426D	probably damaging	Het
Cog4	G	A	8: 110,866,672	D472N	probably damaging	Het
Creb3	T	A	4: 43,565,472	L193*	probably null	Het
Cxcr6	A	T	9: 123,810,461	I183F	probably benign	Het
Dbf4	A	G	5: 8,403,664	F253L	probably benign	Het
Dcaf8	T	C	1: 172,172,797	V174A	probably damaging	Het
Ddhd2	T	C	8: 25,735,752	Y526C	probably damaging	Het
Dnal4	A	G	15: 79,763,565	V33A	probably benign	Het
Egfl7	C	T	2: 26,591,040	P188L	probably benign	Het
Ephb3	A	G	16: 21,220,857	E707G	probably damaging	Het
Epn3	C	T	11: 94,496,523	R7H	probably damaging	Het
Fam198b	C	A	3: 79,886,939	S238Y	possibly damaging	Het
Fbp1	T	A	13: 62,867,380	I262F	probably damaging	Het
Fgfbp3	G	A	19: 36,918,688	R177*	probably null	Het
Gbp5	T	C	3: 142,500,710	S52P	probably damaging	Het
Glb1l2	A	T	9: 26,773,981	S282T	probably benign	Het
Glg1	A	T	8: 111,258,799	V133E	possibly damaging	Het
Gm4787	T	G	12: 81,377,175	L736F	probably benign	Het
Gm5565	A	T	5: 146,158,299	S212R	probably benign	Het
Grin2c	T	C	11: 115,249,633	T1220A	probably benign	Het
Grp	T	G	18: 65,886,226	S133A	probably benign	Het
Gstp2	C	A	19: 4,040,713	D147Y	possibly damaging	Het
Igkv14-130	T	C	6: 67,791,408	F84L	probably damaging	Het
Inppl1	T	C	7: 101,826,013	R944G	probably benign	Het
Lama2	A	T	10: 27,369,136	N216K	probably damaging	Het
Lrp2	T	A	2: 69,537,538	D210V	probably damaging	Het
Lrrc2	A	T	9: 110,962,540	Q120L	possibly damaging	Het
Lrriq1	A	G	10: 103,071,194	I1555T	probably benign	Het
Map2	G	A	1: 66,412,518	G189D	probably benign	Het
Mdc1	A	G	17: 35,844,469	E12G	possibly damaging	Het
Mdga2	T	C	12: 66,797,768	D152G	possibly damaging	Het
Med23	A	G	10: 24,874,571	M99V	probably benign	Het
Mutyh	G	A	4: 116,817,070	V273M	probably damaging	Het
Neurod2	T	A	11: 98,327,882	Y152F	probably damaging	Het
Olfr1002	A	C	2: 85,647,724	L199R	probably damaging	Het
Olfr1177-ps	C	T	2: 88,344,013	A247T	probably benign	Het
Olfr898	G	T	9: 38,349,198	L32F	probably benign	Het
Pcdh20	G	C	14: 88,467,026	P946R	probably damaging	Het
Pde6b	T	C	5: 108,423,585		probably null	Het
Pdzrn4	A	T	15: 92,769,881	D638V	possibly damaging	Het
Polr1b	A	G	2: 129,109,292	D275G	possibly damaging	Het
Rnf157	T	A	11: 116,360,317	D127V	probably damaging	Het
Rspo4	T	A	2: 151,867,883	C69*	probably null	Het
Scara3	T	C	14: 65,936,402	T63A	probably benign	Het
Scn2a	G	A	2: 65,683,838	E289K	probably benign	Het
Sh3gl2	A	G	4: 85,377,549	T163A	probably benign	Het
Slc2a10	T	A	2: 165,516,293	F446Y	probably damaging	Het
Snapc1	C	T	12: 73,982,495	R351C	probably damaging	Het
Snx6	A	G	12: 54,768,030	Y169H	possibly damaging	Het
Stab2	A	T	10: 86,861,435	C1996*	probably null	Het
Steap4	A	G	5: 7,980,337	T398A	probably benign	Het
Tep1	A	T	14: 50,866,053	L260Q	probably benign	Het
Tspan12	A	T	6: 21,835,464	V70D	possibly damaging	Het
Ttn	G	A	2: 76,739,018	A27177V	probably damaging	Het
Ube3a	T	C	7: 59,276,122	V237A	possibly damaging	Het
Vil1	G	A	1: 74,421,383	R233H	probably damaging	Het
Xrcc5	A	G	1: 72,393,929	T716A	probably benign	Het
Zbp1	A	G	2: 173,216,990	I18T	probably damaging	Het
Zfp292	A	G	4: 34,807,524	V1845A	probably benign	Het
Zfp407	A	T	18: 84,561,268	N573K	possibly damaging	Het
Zfp64	T	C	2: 168,925,815	T626A	probably benign	Het

Other mutations in Chuk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Chuk	APN	19	44088023	missense	possibly damaging	0.56
IGL00585:Chuk	APN	19	44078312	missense	probably damaging	0.99
IGL00662:Chuk	APN	19	44097210	missense	possibly damaging	0.64
IGL01419:Chuk	APN	19	44096981	missense	probably damaging	1.00
IGL01728:Chuk	APN	19	44098646	missense	possibly damaging	0.94
IGL01753:Chuk	APN	19	44098576	splice site	probably benign
woodchuck	UTSW	19	44078977	missense	probably damaging	1.00
PIT4382001:Chuk	UTSW	19	44098607	missense	probably damaging	0.99
R0107:Chuk	UTSW	19	44096919	missense	probably damaging	1.00
R0107:Chuk	UTSW	19	44096919	missense	probably damaging	1.00
R0504:Chuk	UTSW	19	44081938	splice site	probably benign
R0731:Chuk	UTSW	19	44103766	splice site	probably benign
R0846:Chuk	UTSW	19	44091028	missense	probably damaging	1.00
R1433:Chuk	UTSW	19	44078958	missense	probably null	1.00
R1585:Chuk	UTSW	19	44077373	missense	possibly damaging	0.89
R2020:Chuk	UTSW	19	44107343	missense	possibly damaging	0.59
R2179:Chuk	UTSW	19	44103721	missense	possibly damaging	0.95
R2441:Chuk	UTSW	19	44096921	missense	probably damaging	1.00
R4125:Chuk	UTSW	19	44100174	missense	probably null	0.00
R4180:Chuk	UTSW	19	44101840	missense	probably benign	0.01
R4746:Chuk	UTSW	19	44088771	missense	possibly damaging	0.86
R4815:Chuk	UTSW	19	44077247	nonsense	probably null
R4852:Chuk	UTSW	19	44088758	missense	possibly damaging	0.91
R5330:Chuk	UTSW	19	44078955	missense	probably damaging	1.00
R5331:Chuk	UTSW	19	44078955	missense	probably damaging	1.00
R5517:Chuk	UTSW	19	44097533	critical splice acceptor site	probably null
R5854:Chuk	UTSW	19	44081957	missense	probably benign	0.00
R6149:Chuk	UTSW	19	44101831	missense	probably damaging	1.00
R6161:Chuk	UTSW	19	44082637	missense	probably damaging	1.00
R6232:Chuk	UTSW	19	44096992	missense	probably benign	0.21
R6768:Chuk	UTSW	19	44096951	missense	probably damaging	0.96
R6865:Chuk	UTSW	19	44086915	nonsense	probably null
R7916:Chuk	UTSW	19	44096981	missense	probably damaging	1.00
R8038:Chuk	UTSW	19	44078977	missense	probably damaging	1.00
R8064:Chuk	UTSW	19	44082676	missense	probably damaging	1.00
R8187:Chuk	UTSW	19	44091112	missense	probably benign	0.05
R8272:Chuk	UTSW	19	44103736	missense	possibly damaging	0.75
R8481:Chuk	UTSW	19	44096239	missense	probably benign	0.00
R8739:Chuk	UTSW	19	44088696	missense	probably benign	0.01
R8852:Chuk	UTSW	19	44087968	missense	possibly damaging	0.96
R8860:Chuk	UTSW	19	44087968	missense	possibly damaging	0.96
R9176:Chuk	UTSW	19	44088003	missense	probably damaging	1.00
R9228:Chuk	UTSW	19	44107350	missense	probably damaging	1.00
R9328:Chuk	UTSW	19	44096983	nonsense	probably null
R9380:Chuk	UTSW	19	44074519	missense	unknown
R9444:Chuk	UTSW	19	44086946	missense
R9717:Chuk	UTSW	19	44082670	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- GAGCCACTGTTCCATAGAGAAG -3'
(R):5'- TGATTGATTGAAAGCTGTAGGC -3'

Sequencing Primer
(F):5'- CAAGCAGTTACGAGCACCTGTTG -3'
(R):5'- TGCTACATAGGGATTCCATGCCAG -3'

Posted On

2019-06-07