Incidental Mutation 'PIT4382001:Slc10a5'
ID 554666
Institutional Source Beutler Lab
Gene Symbol Slc10a5
Ensembl Gene ENSMUSG00000058921
Gene Name solute carrier family 10 (sodium/bile acid cotransporter family), member 5
Synonyms LOC241877
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # PIT4382001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 10396794-10400716 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10400507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000077808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037839] [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
AlphaFold Q5PT54
Predicted Effect probably benign
Transcript: ENSMUST00000037839
SMART Domains Protein: ENSMUSP00000037459
Gene: ENSMUSG00000039795

DomainStartEndE-ValueType
ZnF_AN1 10 49 1.4e-8 SMART
ZnF_AN1 64 103 2.64e-4 SMART
low complexity region 121 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078748
AA Change: D51G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921
AA Change: D51G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
AA Change: D51G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392
AA Change: D51G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 136,978,711 (GRCm39) H144N unknown Het
Acsm4 C T 7: 119,297,798 (GRCm39) T145M probably damaging Het
Adam10 T C 9: 70,673,363 (GRCm39) L498P probably damaging Het
Adgrl2 A G 3: 148,522,934 (GRCm39) L430P Het
Alk T C 17: 72,256,916 (GRCm39) M648V probably benign Het
Arhgap35 T C 7: 16,297,794 (GRCm39) R424G possibly damaging Het
Baiap2l1 T C 5: 144,215,480 (GRCm39) K342E possibly damaging Het
Ccdc54 C T 16: 50,411,219 (GRCm39) V16M probably damaging Het
Chil3 T G 3: 106,055,975 (GRCm39) D366A probably damaging Het
Chuk A G 19: 44,087,046 (GRCm39) V151A probably damaging Het
Cpd T G 11: 76,688,614 (GRCm39) H886P probably benign Het
Cped1 T A 6: 22,222,449 (GRCm39) C736* probably null Het
Creb3l3 T C 10: 80,920,746 (GRCm39) E428G probably benign Het
Csad G A 15: 102,097,085 (GRCm39) L7F probably benign Het
Dnah1 C T 14: 31,006,412 (GRCm39) D2255N probably damaging Het
Dnajb12 T C 10: 59,728,508 (GRCm39) Y159H probably damaging Het
Dpysl4 T A 7: 138,669,494 (GRCm39) Y57* probably null Het
F2rl1 T G 13: 95,650,154 (GRCm39) N243H probably benign Het
Fhl4 T C 10: 84,934,293 (GRCm39) K163E possibly damaging Het
Flot2 T C 11: 77,944,193 (GRCm39) S46P possibly damaging Het
Fsip2 C A 2: 82,821,196 (GRCm39) T5643K possibly damaging Het
Golga4 T A 9: 118,382,521 (GRCm39) Y542N possibly damaging Het
Il17re A G 6: 113,446,038 (GRCm39) T426A probably benign Het
Kdm2a T A 19: 4,393,201 (GRCm39) M385L probably benign Het
Kdm3b T C 18: 34,942,140 (GRCm39) S744P probably damaging Het
Krtap20-1 T A 16: 88,881,048 (GRCm39) Y26* probably null Het
Lama2 T C 10: 27,080,901 (GRCm39) D974G probably damaging Het
Ldc1 A T 4: 130,112,954 (GRCm39) N147K possibly damaging Het
Lipo5 A T 19: 33,443,339 (GRCm39) L159Q probably null Het
LTO1 T A 7: 144,470,181 (GRCm39) Y37N probably damaging Het
Mau2 C T 8: 70,483,302 (GRCm39) E187K possibly damaging Het
Mrpl9 T C 3: 94,355,136 (GRCm39) L236P probably benign Het
Mta1 A G 12: 113,096,870 (GRCm39) T564A probably benign Het
Mylk C T 16: 34,696,012 (GRCm39) S249L probably damaging Het
Ncor1 G T 11: 62,235,489 (GRCm39) T331K probably damaging Het
Nsun3 T A 16: 62,606,228 (GRCm39) K15N probably damaging Het
Nsun5 A G 5: 135,400,355 (GRCm39) Y132C probably benign Het
Obsl1 T A 1: 75,464,607 (GRCm39) T1605S probably benign Het
Or10a3n A G 7: 108,493,309 (GRCm39) Y107H probably damaging Het
Or51f1 A G 7: 102,505,809 (GRCm39) Y227H probably damaging Het
Or51t4 A T 7: 102,598,656 (GRCm39) Y328F probably benign Het
Or5b109 T C 19: 13,212,259 (GRCm39) I215T probably damaging Het
P2rx1 A G 11: 72,900,026 (GRCm39) N148D probably benign Het
Pogz T A 3: 94,787,107 (GRCm39) S1232T probably damaging Het
Polr3b C A 10: 84,520,049 (GRCm39) T655N probably damaging Het
Prss34 T C 17: 25,517,882 (GRCm39) probably null Het
Rhpn2 A G 7: 35,090,178 (GRCm39) probably null Het
Runx1 T A 16: 92,410,648 (GRCm39) D256V probably damaging Het
Shc1 C A 3: 89,334,715 (GRCm39) Q525K probably benign Het
Slc6a3 A T 13: 73,719,642 (GRCm39) N557I probably benign Het
Slmap C T 14: 26,254,586 (GRCm39) R32H probably damaging Het
Spata31d1c T C 13: 65,183,985 (GRCm39) I509T probably benign Het
Spata31e4 A T 13: 50,855,007 (GRCm39) E215V probably damaging Het
Srr C A 11: 74,801,134 (GRCm39) V138F probably benign Het
Tas2r118 G A 6: 23,969,785 (GRCm39) T92I possibly damaging Het
Tcaf2 A T 6: 42,601,300 (GRCm39) *920K probably null Het
Tenm2 T A 11: 35,954,729 (GRCm39) Y1141F probably damaging Het
Thoc6 T C 17: 23,887,841 (GRCm39) N322S probably benign Het
Tlcd2 A G 11: 75,359,417 (GRCm39) I70V probably benign Het
Tmem214 A G 5: 31,028,795 (GRCm39) D128G possibly damaging Het
Trav13d-4 T C 14: 53,995,238 (GRCm39) V64A probably benign Het
Tyro3 T C 2: 119,632,845 (GRCm39) W122R probably damaging Het
Ugcg A G 4: 59,213,246 (GRCm39) D144G possibly damaging Het
Uimc1 T C 13: 55,178,828 (GRCm39) D627G probably benign Het
Utp6 T C 11: 79,853,099 (GRCm39) I13V probably benign Het
Vmn2r99 A G 17: 19,614,605 (GRCm39) K775R probably damaging Het
Wdfy3 CG C 5: 102,030,827 (GRCm39) probably null Het
Zw10 C T 9: 48,982,944 (GRCm39) T525I probably benign Het
Other mutations in Slc10a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Slc10a5 APN 3 10,400,369 (GRCm39) missense probably benign 0.05
IGL01785:Slc10a5 APN 3 10,400,259 (GRCm39) missense probably benign 0.00
IGL01823:Slc10a5 APN 3 10,399,574 (GRCm39) missense possibly damaging 0.93
IGL01915:Slc10a5 APN 3 10,400,580 (GRCm39) missense probably damaging 0.98
IGL02522:Slc10a5 APN 3 10,400,181 (GRCm39) missense probably benign 0.09
IGL02721:Slc10a5 APN 3 10,399,595 (GRCm39) missense probably benign 0.01
R0558:Slc10a5 UTSW 3 10,400,177 (GRCm39) missense probably damaging 1.00
R0961:Slc10a5 UTSW 3 10,399,484 (GRCm39) missense probably benign 0.00
R1747:Slc10a5 UTSW 3 10,400,451 (GRCm39) missense probably benign 0.04
R1889:Slc10a5 UTSW 3 10,400,550 (GRCm39) missense probably benign 0.33
R2130:Slc10a5 UTSW 3 10,400,278 (GRCm39) missense probably benign
R2171:Slc10a5 UTSW 3 10,400,342 (GRCm39) missense possibly damaging 0.59
R2970:Slc10a5 UTSW 3 10,400,127 (GRCm39) missense probably damaging 1.00
R2972:Slc10a5 UTSW 3 10,399,517 (GRCm39) missense probably damaging 0.98
R2973:Slc10a5 UTSW 3 10,399,517 (GRCm39) missense probably damaging 0.98
R4241:Slc10a5 UTSW 3 10,400,520 (GRCm39) missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10,400,360 (GRCm39) missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10,400,359 (GRCm39) missense probably damaging 1.00
R4790:Slc10a5 UTSW 3 10,400,096 (GRCm39) missense probably damaging 1.00
R4834:Slc10a5 UTSW 3 10,399,859 (GRCm39) missense probably damaging 0.97
R4891:Slc10a5 UTSW 3 10,399,685 (GRCm39) missense possibly damaging 0.79
R5220:Slc10a5 UTSW 3 10,400,148 (GRCm39) nonsense probably null
R5548:Slc10a5 UTSW 3 10,399,377 (GRCm39) missense probably benign
R5748:Slc10a5 UTSW 3 10,400,391 (GRCm39) missense probably benign 0.00
R6573:Slc10a5 UTSW 3 10,400,110 (GRCm39) missense probably damaging 1.00
R6909:Slc10a5 UTSW 3 10,400,655 (GRCm39) missense possibly damaging 0.90
R7355:Slc10a5 UTSW 3 10,399,375 (GRCm39) nonsense probably null
R7807:Slc10a5 UTSW 3 10,400,529 (GRCm39) missense probably benign 0.00
R7866:Slc10a5 UTSW 3 10,399,532 (GRCm39) missense probably damaging 0.99
R8219:Slc10a5 UTSW 3 10,400,384 (GRCm39) missense probably benign 0.32
R8975:Slc10a5 UTSW 3 10,399,670 (GRCm39) missense probably benign 0.17
R9044:Slc10a5 UTSW 3 10,399,792 (GRCm39) missense probably damaging 1.00
R9514:Slc10a5 UTSW 3 10,400,532 (GRCm39) missense possibly damaging 0.83
Z1176:Slc10a5 UTSW 3 10,399,547 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCCGTCTGTCTGAACAC -3'
(R):5'- GGCACACATGGTTTGTTTAAAC -3'

Sequencing Primer
(F):5'- ACATTCTTTAGCTCGTCGATGAG -3'
(R):5'- TGTTTAAACTTTCAAAATGTCTGGC -3'
Posted On 2019-06-07