Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4382001:Adgrl2'

554671

Institutional Source

Beutler Lab

Gene Symbol

Adgrl2

Ensembl Gene

ENSMUSG00000028184

Gene Name

adhesion G protein-coupled receptor L2

Synonyms

Lec1, Lphn2, Lphh1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4382001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148815583-148990555 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148817298 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 430 (L430P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]

Predicted Effect

probably benign
Transcript: ENSMUST00000106128
AA Change: L1447P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: L1447P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.3e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	4.6e-69	PFAM
Pfam:Latrophilin	1128	1487	6.4e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168352
AA Change: L199P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184
AA Change: L199P

Domain	Start	End	E-Value	Type
Pfam:Latrophilin	1	239	2.5e-122	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195988
AA Change: L1395P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: L1395P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.3e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.1e-66	PFAM
Pfam:Latrophilin	1119	1189	2.2e-28	PFAM
Pfam:Latrophilin	1184	1435	5.5e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196526

SMART Domains

Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	8.7e-24	PFAM
OLF	138	394	3.4e-142	SMART
HormR	465	530	2e-22	SMART
Pfam:GAIN	533	747	1.1e-54	PFAM
GPS	771	823	2.2e-27	SMART
Pfam:7tm_2	831	1067	6.5e-68	PFAM
Pfam:Latrophilin	1087	1158	9.9e-36	PFAM
low complexity region	1163	1173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197348

Predicted Effect

probably benign
Transcript: ENSMUST00000197567
AA Change: L1447P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: L1447P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	1.9e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.1e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	6.4e-69	PFAM
Pfam:Latrophilin	1128	1487	2.8e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197925

Predicted Effect

probably benign
Transcript: ENSMUST00000198779
AA Change: L1412P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: L1412P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1084	1.8e-66	PFAM
Pfam:Latrophilin	1104	1452	7e-174	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199059
AA Change: L1427P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: L1427P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.3e-66	PFAM
Pfam:Latrophilin	1119	1467	7.1e-174	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199238
AA Change: L1438P

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: L1438P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.4e-66	PFAM
Pfam:Latrophilin	1119	1478	1.6e-187	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199750
AA Change: L1301P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: L1301P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.1e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	403	468	1.9e-22	SMART
GPS	709	761	2.1e-27	SMART
Pfam:7tm_2	769	1005	1.6e-66	PFAM
Pfam:Latrophilin	1025	1095	2e-28	PFAM
Pfam:Latrophilin	1090	1341	4.9e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200154

SMART Domains

Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.2e-66	PFAM
Pfam:Latrophilin	1087	1123	2.2e-4	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200216

Predicted Effect

probably benign
Transcript: ENSMUST00000200456

Predicted Effect

probably benign
Transcript: ENSMUST00000200543
AA Change: L1363P

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: L1363P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.2e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.7e-66	PFAM
Pfam:Latrophilin	1087	1157	2.1e-28	PFAM
Pfam:Latrophilin	1152	1403	5.3e-123	PFAM

Meta Mutation Damage Score

0.4185

Coding Region Coverage

1x: 92.9%
3x: 90.5%
10x: 84.6%
20x: 72.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	G	T	7: 137,376,982	H144N	unknown	Het
Acsm4	C	T	7: 119,698,575	T145M	probably damaging	Het
Adam10	T	C	9: 70,766,081	L498P	probably damaging	Het
Alk	T	C	17: 71,949,921	M648V	probably benign	Het
Arhgap35	T	C	7: 16,563,869	R424G	possibly damaging	Het
Baiap2l1	T	C	5: 144,278,670	K342E	possibly damaging	Het
Ccdc54	C	T	16: 50,590,856	V16M	probably damaging	Het
Chil3	T	G	3: 106,148,659	D366A	probably damaging	Het
Chuk	A	G	19: 44,098,607	V151A	probably damaging	Het
Cpd	T	G	11: 76,797,788	H886P	probably benign	Het
Cped1	T	A	6: 22,222,450	C736*	probably null	Het
Creb3l3	T	C	10: 81,084,912	E428G	probably benign	Het
Csad	G	A	15: 102,188,650	L7F	probably benign	Het
Dnah1	C	T	14: 31,284,455	D2255N	probably damaging	Het
Dnajb12	T	C	10: 59,892,686	Y159H	probably damaging	Het
Dpysl4	T	A	7: 139,089,578	Y57*	probably null	Het
F2rl1	T	G	13: 95,513,646	N243H	probably benign	Het
Fhl4	T	C	10: 85,098,429	K163E	possibly damaging	Het
Flot2	T	C	11: 78,053,367	S46P	possibly damaging	Het
Fsip2	C	A	2: 82,990,852	T5643K	possibly damaging	Het
Gm853	A	T	4: 130,219,161	N147K	possibly damaging	Het
Gm8765	A	T	13: 50,700,971	E215V	probably damaging	Het
Golga4	T	A	9: 118,553,453	Y542N	possibly damaging	Het
Il17re	A	G	6: 113,469,077	T426A	probably benign	Het
Kdm2a	T	A	19: 4,343,173	M385L	probably benign	Het
Kdm3b	T	C	18: 34,809,087	S744P	probably damaging	Het
Krtap6-3	T	A	16: 89,084,160	Y26*	probably null	Het
Lama2	T	C	10: 27,204,905	D974G	probably damaging	Het
Lipo5	A	T	19: 33,465,939	L159Q	probably null	Het
Mau2	C	T	8: 70,030,652	E187K	possibly damaging	Het
Mrpl9	T	C	3: 94,447,829	L236P	probably benign	Het
Mta1	A	G	12: 113,133,250	T564A	probably benign	Het
Mylk	C	T	16: 34,875,642	S249L	probably damaging	Het
Ncor1	G	T	11: 62,344,663	T331K	probably damaging	Het
Nsun3	T	A	16: 62,785,865	K15N	probably damaging	Het
Nsun5	A	G	5: 135,371,501	Y132C	probably benign	Het
Obsl1	T	A	1: 75,487,963	T1605S	probably benign	Het
Olfr1463	T	C	19: 13,234,895	I215T	probably damaging	Het
Olfr519	A	G	7: 108,894,102	Y107H	probably damaging	Het
Olfr566	A	G	7: 102,856,602	Y227H	probably damaging	Het
Olfr574	A	T	7: 102,949,449	Y328F	probably benign	Het
Oraov1	T	A	7: 144,916,444	Y37N	probably damaging	Het
P2rx1	A	G	11: 73,009,200	N148D	probably benign	Het
Pogz	T	A	3: 94,879,796	S1232T	probably damaging	Het
Polr3b	C	A	10: 84,684,185	T655N	probably damaging	Het
Prss34	T	C	17: 25,298,908		probably null	Het
Rhpn2	A	G	7: 35,390,753		probably null	Het
Runx1	T	A	16: 92,613,760	D256V	probably damaging	Het
Shc1	C	A	3: 89,427,408	Q525K	probably benign	Het
Slc10a5	T	C	3: 10,335,447	D51G	probably benign	Het
Slc6a3	A	T	13: 73,571,523	N557I	probably benign	Het
Slmap	C	T	14: 26,533,431	R32H	probably damaging	Het
Spata31d1c	T	C	13: 65,036,171	I509T	probably benign	Het
Srr	C	A	11: 74,910,308	V138F	probably benign	Het
Tas2r118	G	A	6: 23,969,786	T92I	possibly damaging	Het
Tcaf2	A	T	6: 42,624,366	*920K	probably null	Het
Tenm2	T	A	11: 36,063,902	Y1141F	probably damaging	Het
Thoc6	T	C	17: 23,668,867	N322S	probably benign	Het
Tlcd2	A	G	11: 75,468,591	I70V	probably benign	Het
Tmem214	A	G	5: 30,871,451	D128G	possibly damaging	Het
Trav13-4-dv7	T	C	14: 53,757,781	V64A	probably benign	Het
Tyro3	T	C	2: 119,802,364	W122R	probably damaging	Het
Ugcg	A	G	4: 59,213,246	D144G	possibly damaging	Het
Uimc1	T	C	13: 55,031,015	D627G	probably benign	Het
Utp6	T	C	11: 79,962,273	I13V	probably benign	Het
Vmn2r99	A	G	17: 19,394,343	K775R	probably damaging	Het
Wdfy3	CG	C	5: 101,882,961		probably null	Het
Zw10	C	T	9: 49,071,644	T525I	probably benign	Het

Other mutations in Adgrl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Adgrl2	APN	3	148865608	missense	probably damaging	0.99
IGL00572:Adgrl2	APN	3	148826498	missense	probably damaging	1.00
IGL01624:Adgrl2	APN	3	148836527	missense	probably damaging	1.00
IGL01796:Adgrl2	APN	3	148858975	missense	probably damaging	1.00
IGL02380:Adgrl2	APN	3	148828489	nonsense	probably null
IGL02468:Adgrl2	APN	3	148890480	missense	probably damaging	1.00
IGL02708:Adgrl2	APN	3	148826525	missense	probably damaging	0.96
IGL02869:Adgrl2	APN	3	148890605	missense	probably damaging	1.00
IGL03248:Adgrl2	APN	3	148817400	missense	probably damaging	1.00
IGL03343:Adgrl2	APN	3	148859380	missense	probably damaging	0.98
P0157:Adgrl2	UTSW	3	148859063	missense	probably damaging	1.00
PIT4544001:Adgrl2	UTSW	3	148890521	missense	probably damaging	1.00
R0165:Adgrl2	UTSW	3	148852863	splice site	probably benign
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0344:Adgrl2	UTSW	3	148865595	splice site	probably null
R0488:Adgrl2	UTSW	3	148846905	missense	probably damaging	1.00
R0542:Adgrl2	UTSW	3	148859218	missense	probably damaging	1.00
R0630:Adgrl2	UTSW	3	148839244	missense	probably damaging	0.98
R0674:Adgrl2	UTSW	3	148837679	missense	possibly damaging	0.91
R1401:Adgrl2	UTSW	3	148822981	missense	probably damaging	0.99
R1543:Adgrl2	UTSW	3	148859273	missense	probably damaging	1.00
R1575:Adgrl2	UTSW	3	148852762	missense	probably benign	0.17
R1645:Adgrl2	UTSW	3	148865608	missense	probably damaging	1.00
R1780:Adgrl2	UTSW	3	148852593	missense	probably damaging	1.00
R1992:Adgrl2	UTSW	3	148817244	missense	possibly damaging	0.89
R2014:Adgrl2	UTSW	3	148826475	missense	probably damaging	1.00
R2130:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2131:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2400:Adgrl2	UTSW	3	148851934	missense	probably damaging	1.00
R2997:Adgrl2	UTSW	3	148817649	missense	probably damaging	1.00
R3161:Adgrl2	UTSW	3	148817551	missense	probably damaging	1.00
R3416:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3417:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3551:Adgrl2	UTSW	3	148858963	missense	probably damaging	1.00
R3760:Adgrl2	UTSW	3	148817235	missense	probably damaging	1.00
R4355:Adgrl2	UTSW	3	148839152	missense	probably damaging	1.00
R4850:Adgrl2	UTSW	3	148859020	missense	probably damaging	1.00
R4911:Adgrl2	UTSW	3	148890463	missense	probably damaging	0.99
R4945:Adgrl2	UTSW	3	148823036	missense	probably damaging	0.99
R5313:Adgrl2	UTSW	3	148823713	missense	probably damaging	1.00
R5339:Adgrl2	UTSW	3	148817844	missense	probably benign	0.01
R5540:Adgrl2	UTSW	3	148837562	critical splice donor site	probably null
R5583:Adgrl2	UTSW	3	148859164	missense	probably damaging	1.00
R5890:Adgrl2	UTSW	3	148859175	missense	probably damaging	1.00
R6170:Adgrl2	UTSW	3	148823009	missense	probably damaging	1.00
R6197:Adgrl2	UTSW	3	148858942	missense	probably damaging	1.00
R6284:Adgrl2	UTSW	3	148826507	missense	probably damaging	1.00
R6877:Adgrl2	UTSW	3	148817286	missense	probably damaging	1.00
R7048:Adgrl2	UTSW	3	148846929	missense	probably damaging	1.00
R7205:Adgrl2	UTSW	3	148858949	missense	probably damaging	1.00
R7326:Adgrl2	UTSW	3	148846870	missense	probably benign	0.00
R7348:Adgrl2	UTSW	3	148817766	missense
R7382:Adgrl2	UTSW	3	148817283	missense
R7486:Adgrl2	UTSW	3	148817694	missense
R7498:Adgrl2	UTSW	3	148859216	nonsense	probably null
R7644:Adgrl2	UTSW	3	148839153	missense	probably damaging	1.00
R7690:Adgrl2	UTSW	3	148817298	missense
R7742:Adgrl2	UTSW	3	148836428	missense	probably damaging	1.00
R7745:Adgrl2	UTSW	3	148836458	missense	probably damaging	1.00
R8291:Adgrl2	UTSW	3	148850918	missense	possibly damaging	0.93
R8326:Adgrl2	UTSW	3	148827554	missense
R8343:Adgrl2	UTSW	3	148846906	missense	probably damaging	1.00
R8344:Adgrl2	UTSW	3	148859525	missense	probably damaging	0.98
R8487:Adgrl2	UTSW	3	148859486	missense	probably benign	0.06
RF007:Adgrl2	UTSW	3	148839248	missense	probably damaging	1.00
X0009:Adgrl2	UTSW	3	148852654	missense	probably damaging	1.00
X0019:Adgrl2	UTSW	3	148865594	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGCGTCTCTATCAATTAATACTTGC -3'
(R):5'- AGGCAACAGACAGCTACGTC -3'

Sequencing Primer
(F):5'- AATACTTGCATGTGGCCCTAG -3'
(R):5'- AGCTACGTCTCCCAGCTGAC -3'

Posted On

2019-06-07