Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4382001:Ugcg'

554672

Institutional Source

Beutler Lab

Gene Symbol

Ugcg

Ensembl Gene

ENSMUSG00000028381

Gene Name

UDP-glucose ceramide glucosyltransferase

Synonyms

Epcs21, Ugcgl, GlcT-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4382001 (G1)

Quality Score

214.009

Status

Not validated

Chromosome

Chromosomal Location

59189257-59222833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59213246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 144 (D144G)

Ref Sequence

ENSEMBL: ENSMUSP00000030074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030074]

AlphaFold

O88693

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030074
AA Change: D144G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: D144G

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	51	278	1.3e-26	PFAM
Pfam:Glyco_transf_21	106	278	8.4e-61	PFAM
Pfam:Glyco_trans_2_3	139	368	9.6e-13	PFAM

Coding Region Coverage

1x: 92.9%
3x: 90.5%
10x: 84.6%
20x: 72.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	G	T	7: 137,376,982	H144N	unknown	Het
Acsm4	C	T	7: 119,698,575	T145M	probably damaging	Het
Adam10	T	C	9: 70,766,081	L498P	probably damaging	Het
Adgrl2	A	G	3: 148,817,298	L430P		Het
Alk	T	C	17: 71,949,921	M648V	probably benign	Het
Arhgap35	T	C	7: 16,563,869	R424G	possibly damaging	Het
Baiap2l1	T	C	5: 144,278,670	K342E	possibly damaging	Het
Ccdc54	C	T	16: 50,590,856	V16M	probably damaging	Het
Chil3	T	G	3: 106,148,659	D366A	probably damaging	Het
Chuk	A	G	19: 44,098,607	V151A	probably damaging	Het
Cpd	T	G	11: 76,797,788	H886P	probably benign	Het
Cped1	T	A	6: 22,222,450	C736*	probably null	Het
Creb3l3	T	C	10: 81,084,912	E428G	probably benign	Het
Csad	G	A	15: 102,188,650	L7F	probably benign	Het
Dnah1	C	T	14: 31,284,455	D2255N	probably damaging	Het
Dnajb12	T	C	10: 59,892,686	Y159H	probably damaging	Het
Dpysl4	T	A	7: 139,089,578	Y57*	probably null	Het
F2rl1	T	G	13: 95,513,646	N243H	probably benign	Het
Fhl4	T	C	10: 85,098,429	K163E	possibly damaging	Het
Flot2	T	C	11: 78,053,367	S46P	possibly damaging	Het
Fsip2	C	A	2: 82,990,852	T5643K	possibly damaging	Het
Gm853	A	T	4: 130,219,161	N147K	possibly damaging	Het
Gm8765	A	T	13: 50,700,971	E215V	probably damaging	Het
Golga4	T	A	9: 118,553,453	Y542N	possibly damaging	Het
Il17re	A	G	6: 113,469,077	T426A	probably benign	Het
Kdm2a	T	A	19: 4,343,173	M385L	probably benign	Het
Kdm3b	T	C	18: 34,809,087	S744P	probably damaging	Het
Krtap6-3	T	A	16: 89,084,160	Y26*	probably null	Het
Lama2	T	C	10: 27,204,905	D974G	probably damaging	Het
Lipo5	A	T	19: 33,465,939	L159Q	probably null	Het
Mau2	C	T	8: 70,030,652	E187K	possibly damaging	Het
Mrpl9	T	C	3: 94,447,829	L236P	probably benign	Het
Mta1	A	G	12: 113,133,250	T564A	probably benign	Het
Mylk	C	T	16: 34,875,642	S249L	probably damaging	Het
Ncor1	G	T	11: 62,344,663	T331K	probably damaging	Het
Nsun3	T	A	16: 62,785,865	K15N	probably damaging	Het
Nsun5	A	G	5: 135,371,501	Y132C	probably benign	Het
Obsl1	T	A	1: 75,487,963	T1605S	probably benign	Het
Olfr1463	T	C	19: 13,234,895	I215T	probably damaging	Het
Olfr519	A	G	7: 108,894,102	Y107H	probably damaging	Het
Olfr566	A	G	7: 102,856,602	Y227H	probably damaging	Het
Olfr574	A	T	7: 102,949,449	Y328F	probably benign	Het
Oraov1	T	A	7: 144,916,444	Y37N	probably damaging	Het
P2rx1	A	G	11: 73,009,200	N148D	probably benign	Het
Pogz	T	A	3: 94,879,796	S1232T	probably damaging	Het
Polr3b	C	A	10: 84,684,185	T655N	probably damaging	Het
Prss34	T	C	17: 25,298,908		probably null	Het
Rhpn2	A	G	7: 35,390,753		probably null	Het
Runx1	T	A	16: 92,613,760	D256V	probably damaging	Het
Shc1	C	A	3: 89,427,408	Q525K	probably benign	Het
Slc10a5	T	C	3: 10,335,447	D51G	probably benign	Het
Slc6a3	A	T	13: 73,571,523	N557I	probably benign	Het
Slmap	C	T	14: 26,533,431	R32H	probably damaging	Het
Spata31d1c	T	C	13: 65,036,171	I509T	probably benign	Het
Srr	C	A	11: 74,910,308	V138F	probably benign	Het
Tas2r118	G	A	6: 23,969,786	T92I	possibly damaging	Het
Tcaf2	A	T	6: 42,624,366	*920K	probably null	Het
Tenm2	T	A	11: 36,063,902	Y1141F	probably damaging	Het
Thoc6	T	C	17: 23,668,867	N322S	probably benign	Het
Tlcd2	A	G	11: 75,468,591	I70V	probably benign	Het
Tmem214	A	G	5: 30,871,451	D128G	possibly damaging	Het
Trav13-4-dv7	T	C	14: 53,757,781	V64A	probably benign	Het
Tyro3	T	C	2: 119,802,364	W122R	probably damaging	Het
Uimc1	T	C	13: 55,031,015	D627G	probably benign	Het
Utp6	T	C	11: 79,962,273	I13V	probably benign	Het
Vmn2r99	A	G	17: 19,394,343	K775R	probably damaging	Het
Wdfy3	CG	C	5: 101,882,961		probably null	Het
Zw10	C	T	9: 49,071,644	T525I	probably benign	Het

Other mutations in Ugcg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Ugcg	APN	4	59213865	missense	possibly damaging	0.94
IGL01768:Ugcg	APN	4	59217216	critical splice donor site	probably null
IGL02636:Ugcg	APN	4	59207763	missense	possibly damaging	0.73
IGL02672:Ugcg	APN	4	59218587	splice site	probably benign
IGL02798:Ugcg	APN	4	59220346	missense	probably damaging	1.00
congee	UTSW	4	59207798	missense	probably benign	0.17
cream_o_wheat	UTSW	4	59220387	missense	possibly damaging	0.91
gruel	UTSW	4	59189690	missense	probably benign
Porridge	UTSW	4	59219530	missense	possibly damaging	0.86
slop	UTSW	4	59211883	missense	probably benign	0.16
wheatina	UTSW	4	59220272	missense	probably damaging	0.96
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0119:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0230:Ugcg	UTSW	4	59189739	nonsense	probably null
R0299:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0384:Ugcg	UTSW	4	59220387	missense	possibly damaging	0.91
R0499:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0645:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0688:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0726:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0802:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0803:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0811:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0812:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0828:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0831:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0944:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0945:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0947:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1104:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1209:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1210:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1252:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1253:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1255:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1488:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1490:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1548:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1698:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1771:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1776:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1781:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1794:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1840:Ugcg	UTSW	4	59219517	missense	probably damaging	1.00
R1942:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2228:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2229:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2237:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2239:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2314:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2338:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2340:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2422:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2426:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2433:Ugcg	UTSW	4	59207876	missense	possibly damaging	0.89
R2680:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3076:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3078:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3689:Ugcg	UTSW	4	59211883	missense	probably benign	0.16
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3733:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3766:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3767:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3768:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3769:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3771:Ugcg	UTSW	4	59189690	missense	probably benign
R3847:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3848:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3916:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3917:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3958:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3959:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4023:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4024:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4025:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4065:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4066:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4427:Ugcg	UTSW	4	59219555	missense	probably benign	0.02
R5842:Ugcg	UTSW	4	59219545	missense	possibly damaging	0.93
R6012:Ugcg	UTSW	4	59220272	missense	probably damaging	0.96
R6080:Ugcg	UTSW	4	59218524	missense	possibly damaging	0.70
R6762:Ugcg	UTSW	4	59219530	missense	possibly damaging	0.86
R7194:Ugcg	UTSW	4	59213210	missense	probably damaging	0.99
R7286:Ugcg	UTSW	4	59217111	missense	possibly damaging	0.95
R7362:Ugcg	UTSW	4	59217109	missense	probably damaging	1.00
R7472:Ugcg	UTSW	4	59217156	missense	probably benign
R7638:Ugcg	UTSW	4	59220299	missense	probably benign	0.26
R7866:Ugcg	UTSW	4	59211927	missense	possibly damaging	0.71
R8170:Ugcg	UTSW	4	59211974	missense	possibly damaging	0.71
R8488:Ugcg	UTSW	4	59213896	missense	probably benign	0.00
R8793:Ugcg	UTSW	4	59207794	missense	probably benign	0.22
R9441:Ugcg	UTSW	4	59207843	missense	probably damaging	1.00
Y4336:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
Y4337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GGGTAACTTCAAAATGAGTCCTGTGG -3'
(R):5'- CAGAGCAGACAGTGGCTATC -3'

Sequencing Primer
(F):5'- TGTATTTGGCATGGCTAAATCAAG -3'
(R):5'- GCAAAGGTTTTAATACATGTACCATC -3'

Posted On

2019-06-07